EMAIL THIS PAGE TO A FRIEND

CGNL1

cingulin-like 1

Synonyms: JACOP
Gene ID:
Human(84952) Summary: This gene encodes a member of the cingulin family. The encoded protein localizes to both adherens and tight cell-cell junctions and mediates junction assembly and maintenance by regulating the activity of the small GTPases RhoA and Rac1. Heterozygous chromosomal rearrangements resulting in association of the promoter for this gene with the aromatase gene are a cause of aromatase excess syndrome. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(68178) cingulin-like 1
Rat(315795) cingulin-like 1
Zebrafish(553350) cingulin-like 1
chicken(415405) cingulin-like 1
domestic cat(101083594) cingulin-like 1
Horse(100068509) cingulin-like 1
cow(517509) cingulin-like 1
dog(487574) cingulin-like 1
sheep(101119219) cingulin-like 1
naked mole-rat(101702451) cingulin-like 1
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032866 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU000281 MISSION® esiRNA esiRNA targeting mouse Cgnl1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032866 Rosetta Predictions human pricing
NM_001108164 Rosetta Predictions rat pricing
NM_026599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073622 predicted 2860
2 SASI_Hs01_00073623 predicted 1830
3 SASI_Hs01_00073625 predicted 1739
4 SASI_Hs01_00073626 predicted 1925
5 SASI_Hs01_00073627 predicted 1101
6 SASI_Hs01_00073628 predicted 3410
7 SASI_Hs01_00073629 predicted 3131
8 SASI_Hs02_00360475 predicted 696
9 SASI_Hs01_00073631 predicted 1715
10 SASI_Hs02_00360476 predicted 195
11 SASI_Hs01_00073624 predicted 496
12 SASI_Hs01_00073630 predicted 2196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108164 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235984 predicted 295
2 SASI_Rn02_00235985 predicted 3140
3 SASI_Rn02_00235986 predicted 3499
4 SASI_Rn02_00235987 predicted 3691
5 SASI_Rn02_00235988 predicted 2070
6 SASI_Rn02_00235989 predicted 4005
7 SASI_Rn02_00235990 predicted 1920
8 SASI_Rn02_00235991 predicted 281
9 SASI_Rn02_00235992 predicted 2243
10 SASI_Rn02_00235993 predicted 2200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056505 predicted 4018
2 SASI_Mm01_00056506 predicted 1824
3 SASI_Mm01_00056507 predicted 1309
4 SASI_Mm02_00330560 predicted 3658
5 SASI_Mm01_00056508 predicted 2681
6 SASI_Mm01_00056509 predicted 3051
7 SASI_Mm01_00056510 predicted 1888
8 SASI_Mm01_00056511 predicted 4091
9 SASI_Mm01_00056512 predicted 3335
10 SASI_Mm01_00056513 predicted 3115
11 SASI_Mm01_00056514 predicted 3867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032866
CGNL1 MISSION shRNA Bacterial Glycerol Stock
cingulin-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032866.3-729s21c1
Sequence:CCGGTATGCAGCTCCGTGGTCATAGCTCGAGCTATGACCACGGAGCTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032866.3-3457s21c1
Sequence:CCGGGGACTTAAAGAGCCGGATTATCTCGAGATAATCCGGCTCTTTAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032866.2-1776s1c1
Sequence:CCGGGCACTGATAATGACGATGCTACTCGAGTAGCATCGTCATTATCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032866.2-1579s1c1
Sequence:CCGGCGCTACGCTGATGTTACAGAACTCGAGTTCTGTAACATCAGCGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032866.2-1463s1c1
Sequence:CCGGCAGCCGAACATAGATGGGAAACTCGAGTTTCCCATCTATGTTCGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032866.2-128s1c1
Sequence:CCGGCATCTGAGACTCGCAAGTGATCTCGAGATCACTTGCGAGTCTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032866.2-3454s1c1
Sequence:CCGGCAAGGACTTAAAGAGCCGGATCTCGAGATCCGGCTCTTTAAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032866.2-491s1c1
Sequence:CCGGCCATCTCACCTGCTGAACTTTCTCGAGAAAGTTCAGCAGGTGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032866.2-3851s1c1
Sequence:CCGGCTGAAGAAGCTGCCGAGTAAACTCGAGTTTACTCGGCAGCTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032866.2-763s1c1
Sequence:CCGGGCAGACCTCAGTGTGTGTAAACTCGAGTTTACACACACTGAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032866
CGNL1 MISSION shRNA shRNA Plasmid DNA
cingulin-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032866.3-729s21c1
Sequence:CCGGTATGCAGCTCCGTGGTCATAGCTCGAGCTATGACCACGGAGCTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032866.3-3457s21c1
Sequence:CCGGGGACTTAAAGAGCCGGATTATCTCGAGATAATCCGGCTCTTTAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032866.2-1776s1c1
Sequence:CCGGGCACTGATAATGACGATGCTACTCGAGTAGCATCGTCATTATCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032866.2-1579s1c1
Sequence:CCGGCGCTACGCTGATGTTACAGAACTCGAGTTCTGTAACATCAGCGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032866.2-1463s1c1
Sequence:CCGGCAGCCGAACATAGATGGGAAACTCGAGTTTCCCATCTATGTTCGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032866.2-128s1c1
Sequence:CCGGCATCTGAGACTCGCAAGTGATCTCGAGATCACTTGCGAGTCTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032866.2-3454s1c1
Sequence:CCGGCAAGGACTTAAAGAGCCGGATCTCGAGATCCGGCTCTTTAAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032866.2-491s1c1
Sequence:CCGGCCATCTCACCTGCTGAACTTTCTCGAGAAAGTTCAGCAGGTGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032866.2-3851s1c1
Sequence:CCGGCTGAAGAAGCTGCCGAGTAAACTCGAGTTTACTCGGCAGCTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032866.2-763s1c1
Sequence:CCGGGCAGACCTCAGTGTGTGTAAACTCGAGTTTACACACACTGAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032866
CGNL1 MISSION shRNA Lentiviral Transduction Particles
cingulin-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032866.3-729s21c1
Sequence:CCGGTATGCAGCTCCGTGGTCATAGCTCGAGCTATGACCACGGAGCTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032866.3-3457s21c1
Sequence:CCGGGGACTTAAAGAGCCGGATTATCTCGAGATAATCCGGCTCTTTAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032866.2-1776s1c1
Sequence:CCGGGCACTGATAATGACGATGCTACTCGAGTAGCATCGTCATTATCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032866.2-1579s1c1
Sequence:CCGGCGCTACGCTGATGTTACAGAACTCGAGTTCTGTAACATCAGCGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032866.2-1463s1c1
Sequence:CCGGCAGCCGAACATAGATGGGAAACTCGAGTTTCCCATCTATGTTCGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032866.2-128s1c1
Sequence:CCGGCATCTGAGACTCGCAAGTGATCTCGAGATCACTTGCGAGTCTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032866.2-3454s1c1
Sequence:CCGGCAAGGACTTAAAGAGCCGGATCTCGAGATCCGGCTCTTTAAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032866.2-491s1c1
Sequence:CCGGCCATCTCACCTGCTGAACTTTCTCGAGAAAGTTCAGCAGGTGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032866.2-3851s1c1
Sequence:CCGGCTGAAGAAGCTGCCGAGTAAACTCGAGTTTACTCGGCAGCTTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032866.2-763s1c1
Sequence:CCGGGCAGACCTCAGTGTGTGTAAACTCGAGTTTACACACACTGAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026599
VALIDATED
CGNL1 MISSION shRNA Bacterial Glycerol Stock
cingulin-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026599.4-3479s1c1
Sequence:CCGGGACTTAAAGAGCCGGATTATCCTCGAGGATAATCCGGCTCTTTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026599.4-5922s1c1
Sequence:CCGGCATGTCATCATTCGATATTTGCTCGAGCAAATATCGAATGATGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026599.4-1553s21c1
Sequence:CCGGTCCCTGCCAGCACCGAATAAACTCGAGTTTATTCGGTGCTGGCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249361    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026599.4-5921s21c1
Sequence:CCGGTCATGTCATCATTCGATATTTCTCGAGAAATATCGAATGATGACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026599.4-3478s21c1
Sequence:CCGGAGACTTAAAGAGCCGGATTATCTCGAGATAATCCGGCTCTTTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026599.4-3872s21c1
Sequence:CCGGCTTAAGACACTGTCTAGTAAACTCGAGTTTACTAGACAGTGTCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026599.4-254s21c1
Sequence:CCGGATTGATGGCCACCCTTATATACTCGAGTATATAAGGGTGGCCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026599.3-251s1c1
Sequence:CCGGGCTTAAGACACTGTCTAGTAACTCGAGTTACTAGACAGTGTCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026599.3-221s1c1
Sequence:CCGGGCAGCTCAACTCTCTGAAGAACTCGAGTTCTTCAGAGAGTTGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026599
VALIDATED
CGNL1 MISSION shRNA shRNA Plasmid DNA
cingulin-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026599.4-3479s1c1
Sequence:CCGGGACTTAAAGAGCCGGATTATCCTCGAGGATAATCCGGCTCTTTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026599.4-5922s1c1
Sequence:CCGGCATGTCATCATTCGATATTTGCTCGAGCAAATATCGAATGATGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026599.4-1553s21c1
Sequence:CCGGTCCCTGCCAGCACCGAATAAACTCGAGTTTATTCGGTGCTGGCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249361    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026599.4-5921s21c1
Sequence:CCGGTCATGTCATCATTCGATATTTCTCGAGAAATATCGAATGATGACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026599.4-3478s21c1
Sequence:CCGGAGACTTAAAGAGCCGGATTATCTCGAGATAATCCGGCTCTTTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026599.4-3872s21c1
Sequence:CCGGCTTAAGACACTGTCTAGTAAACTCGAGTTTACTAGACAGTGTCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026599.4-254s21c1
Sequence:CCGGATTGATGGCCACCCTTATATACTCGAGTATATAAGGGTGGCCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026599.3-251s1c1
Sequence:CCGGGCTTAAGACACTGTCTAGTAACTCGAGTTACTAGACAGTGTCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026599.3-221s1c1
Sequence:CCGGGCAGCTCAACTCTCTGAAGAACTCGAGTTCTTCAGAGAGTTGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026599
VALIDATED
CGNL1 MISSION shRNA Lentiviral Transduction Particles
cingulin-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026599.4-3479s1c1
Sequence:CCGGGACTTAAAGAGCCGGATTATCCTCGAGGATAATCCGGCTCTTTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026599.4-5922s1c1
Sequence:CCGGCATGTCATCATTCGATATTTGCTCGAGCAAATATCGAATGATGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026599.4-1553s21c1
Sequence:CCGGTCCCTGCCAGCACCGAATAAACTCGAGTTTATTCGGTGCTGGCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249361    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026599.4-5921s21c1
Sequence:CCGGTCATGTCATCATTCGATATTTCTCGAGAAATATCGAATGATGACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026599.4-3478s21c1
Sequence:CCGGAGACTTAAAGAGCCGGATTATCTCGAGATAATCCGGCTCTTTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026599.4-3872s21c1
Sequence:CCGGCTTAAGACACTGTCTAGTAAACTCGAGTTTACTAGACAGTGTCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026599.4-254s21c1
Sequence:CCGGATTGATGGCCACCCTTATATACTCGAGTATATAAGGGTGGCCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026599.3-251s1c1
Sequence:CCGGGCTTAAGACACTGTCTAGTAACTCGAGTTACTAGACAGTGTCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026599.3-221s1c1
Sequence:CCGGGCAGCTCAACTCTCTGAAGAACTCGAGTTCTTCAGAGAGTTGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks