EMAIL THIS PAGE TO A FRIEND

CGREF1

cell growth regulator with EF-hand domain 1

118 Gene Product Result for
Synonyms: CGR11
Gene ID:
Mouse(68567) cell growth regulator with EF hand domain 1
Rat(245918) cell growth regulator with EF hand domain 1
dog(483006) cell growth regulator with EF-hand domain 1
cow(507586) cell growth regulator with EF-hand domain 1
domestic cat(101080779) cell growth regulator with EF-hand domain 1
naked mole-rat(101705226) cell growth regulator with EF-hand domain 1
domestic guinea pig(100720076) cell growth regulator with EF-hand domain 1
sheep(101114762) cell growth regulator with EF-hand domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006569 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_181420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_181420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_181420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006569 Rosetta Predictions human pricing
NM_139087 Rosetta Predictions rat pricing
XM_181420 Rosetta Predictions mouse pricing
XM_908550 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146396 predicted 279
2 SASI_Hs01_00146398 predicted 446
3 SASI_Hs02_00341849 predicted 606
4 SASI_Hs01_00146399 predicted 1135
5 SASI_Hs01_00146400 predicted 490
6 SASI_Hs01_00146402 predicted 1142
7 SASI_Hs01_00146403 predicted 1107
8 SASI_Hs01_00146404 predicted 498
9 SASI_Hs02_00341850 predicted 1286
10 SASI_Hs02_00341851 predicted 596
11 SASI_Hs01_00146397 predicted 599
12 SASI_Hs01_00146401 predicted 617
13 SASI_Hs01_00146405 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080953 predicted 675
2 SASI_Rn01_00080954 predicted 335
3 SASI_Rn01_00080955 predicted 685
4 SASI_Rn01_00080956 predicted 275
5 SASI_Rn01_00080957 predicted 278
6 SASI_Rn01_00080958 predicted 272
7 SASI_Rn02_00268450 predicted 672
8 SASI_Rn01_00080960 predicted 305
9 SASI_Rn02_00268451 predicted 529
10 SASI_Rn02_00268452 predicted 201
11 SASI_Rn01_00080952 predicted 965
12 SASI_Rn01_00080959 predicted 953
13 SASI_Rn01_00080961 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_181420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246011 predicted 329
2 SASI_Mm02_00425458 predicted 391
3 SASI_Mm01_00246012 predicted 393
4 SASI_Mm01_00246013 predicted 380
5 SASI_Mm01_00246015 predicted 1158
6 SASI_Mm01_00246016 predicted 310
7 SASI_Mm01_00246017 predicted 1180
8 SASI_Mm01_00246018 predicted 333
9 SASI_Mm01_00246019 predicted 328
10 SASI_Mm01_00246020 predicted 392
11 SASI_Mm01_00246014 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434194 predicted 1031
2 SASI_Mm02_00434195 predicted 578
3 SASI_Mm02_00434196 predicted 579
4 SASI_Mm02_00434197 predicted 763
5 SASI_Mm02_00434198 predicted 1159
6 SASI_Mm02_00434199 predicted 268
7 SASI_Mm02_00434200 predicted 248
8 SASI_Mm02_00434201 predicted 862
9 SASI_Mm02_00434202 predicted 329
10 SASI_Mm02_00434203 predicted 279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006569
CGREF1 MISSION shRNA Bacterial Glycerol Stock
cell growth regulator with EF-hand domain 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006569.2-1107s1c1
Sequence:CCGGCTGGAGTCTAAGAACACCCAACTCGAGTTGGGTGTTCTTAGACTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006569.2-612s1c1
Sequence:CCGGGTGATATTGATAGTGGACAAACTCGAGTTTGTCCACTATCAATATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006569.2-1142s1c1
Sequence:CCGGGCACATTGTTCAAGTGGAGAACTCGAGTTCTCCACTTGAACAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006569.2-351s1c1
Sequence:CCGGCCAGACTCTGAAGTGCAGCATCTCGAGATGCTGCACTTCAGAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006569.2-427s1c1
Sequence:CCGGGCTACCTAAAGGGACTAGGAACTCGAGTTCCTAGTCCCTTTAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006569.4-765s21c1
Sequence:CCGGGTTGGAAGGCAGTCCCTATTACTCGAGTAATAGGGACTGCCTTCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006569.4-613s21c1
Sequence:CCGGTGATCTTGATAGTGGACAAAGCTCGAGCTTTGTCCACTATCAAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006569.4-1316s21c1
Sequence:CCGGCTCAGGGAGACCCTAAGTTAACTCGAGTTAACTTAGGGTCTCCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006569
CGREF1 MISSION shRNA shRNA Plasmid DNA
cell growth regulator with EF-hand domain 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006569.2-1107s1c1
Sequence:CCGGCTGGAGTCTAAGAACACCCAACTCGAGTTGGGTGTTCTTAGACTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006569.2-612s1c1
Sequence:CCGGGTGATATTGATAGTGGACAAACTCGAGTTTGTCCACTATCAATATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006569.2-1142s1c1
Sequence:CCGGGCACATTGTTCAAGTGGAGAACTCGAGTTCTCCACTTGAACAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006569.2-351s1c1
Sequence:CCGGCCAGACTCTGAAGTGCAGCATCTCGAGATGCTGCACTTCAGAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006569.2-427s1c1
Sequence:CCGGGCTACCTAAAGGGACTAGGAACTCGAGTTCCTAGTCCCTTTAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006569.4-765s21c1
Sequence:CCGGGTTGGAAGGCAGTCCCTATTACTCGAGTAATAGGGACTGCCTTCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006569.4-613s21c1
Sequence:CCGGTGATCTTGATAGTGGACAAAGCTCGAGCTTTGTCCACTATCAAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006569.4-1316s21c1
Sequence:CCGGCTCAGGGAGACCCTAAGTTAACTCGAGTTAACTTAGGGTCTCCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006569
CGREF1 MISSION shRNA Lentiviral Transduction Particles
cell growth regulator with EF-hand domain 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006569.2-1107s1c1
Sequence:CCGGCTGGAGTCTAAGAACACCCAACTCGAGTTGGGTGTTCTTAGACTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006569.2-612s1c1
Sequence:CCGGGTGATATTGATAGTGGACAAACTCGAGTTTGTCCACTATCAATATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006569.2-1142s1c1
Sequence:CCGGGCACATTGTTCAAGTGGAGAACTCGAGTTCTCCACTTGAACAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006569.2-351s1c1
Sequence:CCGGCCAGACTCTGAAGTGCAGCATCTCGAGATGCTGCACTTCAGAGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006569.2-427s1c1
Sequence:CCGGGCTACCTAAAGGGACTAGGAACTCGAGTTCCTAGTCCCTTTAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006569.4-765s21c1
Sequence:CCGGGTTGGAAGGCAGTCCCTATTACTCGAGTAATAGGGACTGCCTTCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006569.4-613s21c1
Sequence:CCGGTGATCTTGATAGTGGACAAAGCTCGAGCTTTGTCCACTATCAAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006569.4-1316s21c1
Sequence:CCGGCTCAGGGAGACCCTAAGTTAACTCGAGTTAACTTAGGGTCTCCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026770
CGREF1 MISSION shRNA Bacterial Glycerol Stock
cell growth regulator with EF-hand domain 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000346637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026770.1-289s21c1
Sequence:CCGGTCCGACATCTGCAGAATTATCCTCGAGGATAATTCTGCAGATGTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026770.1-1079s21c1
Sequence:CCGGACGGTGGTGCAAGCTAGTAACCTCGAGGTTACTAGCTTGCACCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026770.1-161s21c1
Sequence:CCGGAGCGTTGATGCTGCCACTATTCTCGAGAATAGTGGCAGCATCAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026770.1-919s21c1
Sequence:CCGGAGAGCCTAAACACTCCAAATGCTCGAGCATTTGGAGTGTTTAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026770
CGREF1 MISSION shRNA shRNA Plasmid DNA
cell growth regulator with EF-hand domain 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000346637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026770.1-289s21c1
Sequence:CCGGTCCGACATCTGCAGAATTATCCTCGAGGATAATTCTGCAGATGTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026770.1-1079s21c1
Sequence:CCGGACGGTGGTGCAAGCTAGTAACCTCGAGGTTACTAGCTTGCACCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026770.1-161s21c1
Sequence:CCGGAGCGTTGATGCTGCCACTATTCTCGAGAATAGTGGCAGCATCAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026770.1-919s21c1
Sequence:CCGGAGAGCCTAAACACTCCAAATGCTCGAGCATTTGGAGTGTTTAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026770
CGREF1 MISSION shRNA Lentiviral Transduction Particles
cell growth regulator with EF-hand domain 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000346637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026770.1-289s21c1
Sequence:CCGGTCCGACATCTGCAGAATTATCCTCGAGGATAATTCTGCAGATGTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026770.1-1079s21c1
Sequence:CCGGACGGTGGTGCAAGCTAGTAACCTCGAGGTTACTAGCTTGCACCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026770.1-161s21c1
Sequence:CCGGAGCGTTGATGCTGCCACTATTCTCGAGAATAGTGGCAGCATCAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026770.1-919s21c1
Sequence:CCGGAGAGCCTAAACACTCCAAATGCTCGAGCATTTGGAGTGTTTAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_181420
VALIDATED
CGREF1 MISSION shRNA Bacterial Glycerol Stock
cell growth regulator with EF-hand domain 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:XM_181420.6-1190s1c1
Sequence:CCGGACGGTGGTGCAAGCTAGTAACCTCGAGGTTACTAGCTTGCACCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_181420.6-1055s1c1
Sequence:CCGGTGAGGCTCATAGCATCCAATTCTCGAGAATTGGATGCTATGAGCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:XM_181420.6-1030s1c1
Sequence:CCGGAGAGCCTAAACACTCCAAATGCTCGAGCATTTGGAGTGTTTAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:XM_181420.6-400s1c1
Sequence:CCGGTCCGACATCTGCAGAATTATCCTCGAGGATAATTCTGCAGATGTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:XM_181420.6-272s1c1
Sequence:CCGGAGCGTTGATGCTGCCACTATTCTCGAGAATAGTGGCAGCATCAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_181420
VALIDATED
CGREF1 MISSION shRNA shRNA Plasmid DNA
cell growth regulator with EF-hand domain 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:XM_181420.6-1190s1c1
Sequence:CCGGACGGTGGTGCAAGCTAGTAACCTCGAGGTTACTAGCTTGCACCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_181420.6-1055s1c1
Sequence:CCGGTGAGGCTCATAGCATCCAATTCTCGAGAATTGGATGCTATGAGCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:XM_181420.6-1030s1c1
Sequence:CCGGAGAGCCTAAACACTCCAAATGCTCGAGCATTTGGAGTGTTTAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:XM_181420.6-400s1c1
Sequence:CCGGTCCGACATCTGCAGAATTATCCTCGAGGATAATTCTGCAGATGTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:XM_181420.6-272s1c1
Sequence:CCGGAGCGTTGATGCTGCCACTATTCTCGAGAATAGTGGCAGCATCAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_181420
VALIDATED
CGREF1 MISSION shRNA Lentiviral Transduction Particles
cell growth regulator with EF-hand domain 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:XM_181420.6-1190s1c1
Sequence:CCGGACGGTGGTGCAAGCTAGTAACCTCGAGGTTACTAGCTTGCACCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_181420.6-1055s1c1
Sequence:CCGGTGAGGCTCATAGCATCCAATTCTCGAGAATTGGATGCTATGAGCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:XM_181420.6-1030s1c1
Sequence:CCGGAGAGCCTAAACACTCCAAATGCTCGAGCATTTGGAGTGTTTAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:XM_181420.6-400s1c1
Sequence:CCGGTCCGACATCTGCAGAATTATCCTCGAGGATAATTCTGCAGATGTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:XM_181420.6-272s1c1
Sequence:CCGGAGCGTTGATGCTGCCACTATTCTCGAGAATAGTGGCAGCATCAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)