EMAIL THIS PAGE TO A FRIEND

CGRRF1

cell growth regulator with ring finger domain 1

111 Gene Product Result for
Synonyms: CGR19 RNF197
UniProtKB ID: Q99675, Q96BX2
Gene ID:
Mouse(68755) cell growth regulator with ring finger domain 1
Rat(116679) cell growth regulator with ring finger domain 1
sheep(101117166) cell growth regulator with ring finger domain 1
domestic guinea pig(100734076) cell growth regulator with ring finger domain 1
naked mole-rat(101709052) cell growth regulator with ring finger domain 1
Zebrafish(692284) cell growth regulator with ring finger domain 1
cow(534344) cell growth regulator with ring finger domain 1
domestic cat(101101477) cell growth regulator with ring finger domain 1
dog(480328) cell growth regulator with ring finger domain 1
chicken(776040) cell growth regulator with ring finger domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006568 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006568 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006568 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026832 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026832 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026832 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006568 Rosetta Predictions human pricing
NM_053899 Rosetta Predictions rat pricing
NM_026832 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205362 predicted 342
2 SASI_Hs01_00205363 predicted 599
3 SASI_Hs01_00205364 predicted 650
4 SASI_Hs01_00205366 predicted 925
5 SASI_Hs01_00205367 predicted 619
6 SASI_Hs01_00205368 predicted 471
7 SASI_Hs01_00205369 predicted 609
8 SASI_Hs02_00341847 predicted 318
9 SASI_Hs01_00205370 predicted 620
10 SASI_Hs02_00341848 predicted 1061
11 SASI_Hs01_00205361 predicted 1019
12 SASI_Hs01_00205365 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266821 predicted 247
2 SASI_Rn02_00266822 predicted 705
3 SASI_Rn02_00266823 predicted 426
4 SASI_Rn01_00088080 predicted 435
5 SASI_Rn01_00088081 predicted 647
6 SASI_Rn01_00088082 predicted 436
7 SASI_Rn01_00088083 predicted 347
8 SASI_Rn02_00266824 predicted 651
9 SASI_Rn01_00088085 predicted 494
10 SASI_Rn01_00088086 predicted 442
11 SASI_Rn01_00088078 predicted 720
12 SASI_Rn01_00088079 predicted 726
13 SASI_Rn01_00088084 predicted 723
14 SASI_Rn01_00088087 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094893 predicted 462
2 SASI_Mm02_00331004 predicted 372
3 SASI_Mm01_00094894 predicted 638
4 SASI_Mm01_00094895 predicted 593
5 SASI_Mm01_00094896 predicted 584
6 SASI_Mm01_00094897 predicted 354
7 SASI_Mm01_00094898 predicted 420
8 SASI_Mm01_00094899 predicted 774
9 SASI_Mm01_00094901 predicted 507
10 SASI_Mm01_00094902 predicted 967
11 SASI_Mm01_00094900 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006568
VALIDATED
CGRRF1 MISSION shRNA Bacterial Glycerol Stock
cell growth regulator with ring finger domain 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006568.2-737s21c1
Sequence:CCGGCTCTTGGCTCAAGGTCAATTTCTCGAGAAATTGACCTTGAGCCAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006568.2-1110s21c1
Sequence:CCGGAGTACACTTTCTACTAAAGATCTCGAGATCTTTAGTAGAAAGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006568.2-548s21c1
Sequence:CCGGCAGTTACCAAGAGATACTAAACTCGAGTTTAGTATCTCTTGGTAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006568.2-1014s21c1
Sequence:CCGGGCAGGCAGTTTGTTCAGGAATCTCGAGATTCCTGAACAAACTGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006568.1-400s1c1
Sequence:CCGGGCATTAGAAGATGCTCTGTATCTCGAGATACAGAGCATCTTCTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006568.1-366s1c1
Sequence:CCGGGCATGTTTATTGCTTCAGAATCTCGAGATTCTGAAGCAATAAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006568.1-611s1c1
Sequence:CCGGCAGTGATTCATATTCCTGATACTCGAGTATCAGGAATATGAATCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006568.1-550s1c1
Sequence:CCGGGCGCTATTGACCTTAGCTGATCTCGAGATCAGCTAAGGTCAATAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006568.1-950s1c1
Sequence:CCGGGCAGGCAGTTTGTTCAGGAATCTCGAGATTCCTGAACAAACTGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006568
VALIDATED
CGRRF1 MISSION shRNA shRNA Plasmid DNA
cell growth regulator with ring finger domain 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006568.2-737s21c1
Sequence:CCGGCTCTTGGCTCAAGGTCAATTTCTCGAGAAATTGACCTTGAGCCAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006568.2-1110s21c1
Sequence:CCGGAGTACACTTTCTACTAAAGATCTCGAGATCTTTAGTAGAAAGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006568.2-548s21c1
Sequence:CCGGCAGTTACCAAGAGATACTAAACTCGAGTTTAGTATCTCTTGGTAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006568.2-1014s21c1
Sequence:CCGGGCAGGCAGTTTGTTCAGGAATCTCGAGATTCCTGAACAAACTGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006568.1-400s1c1
Sequence:CCGGGCATTAGAAGATGCTCTGTATCTCGAGATACAGAGCATCTTCTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006568.1-366s1c1
Sequence:CCGGGCATGTTTATTGCTTCAGAATCTCGAGATTCTGAAGCAATAAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006568.1-611s1c1
Sequence:CCGGCAGTGATTCATATTCCTGATACTCGAGTATCAGGAATATGAATCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006568.1-550s1c1
Sequence:CCGGGCGCTATTGACCTTAGCTGATCTCGAGATCAGCTAAGGTCAATAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006568.1-950s1c1
Sequence:CCGGGCAGGCAGTTTGTTCAGGAATCTCGAGATTCCTGAACAAACTGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006568
VALIDATED
CGRRF1 MISSION shRNA Lentiviral Transduction Particles
cell growth regulator with ring finger domain 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006568.2-737s21c1
Sequence:CCGGCTCTTGGCTCAAGGTCAATTTCTCGAGAAATTGACCTTGAGCCAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006568.2-1110s21c1
Sequence:CCGGAGTACACTTTCTACTAAAGATCTCGAGATCTTTAGTAGAAAGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006568.2-548s21c1
Sequence:CCGGCAGTTACCAAGAGATACTAAACTCGAGTTTAGTATCTCTTGGTAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006568.2-1014s21c1
Sequence:CCGGGCAGGCAGTTTGTTCAGGAATCTCGAGATTCCTGAACAAACTGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006568.1-400s1c1
Sequence:CCGGGCATTAGAAGATGCTCTGTATCTCGAGATACAGAGCATCTTCTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006568.1-366s1c1
Sequence:CCGGGCATGTTTATTGCTTCAGAATCTCGAGATTCTGAAGCAATAAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006568.1-611s1c1
Sequence:CCGGCAGTGATTCATATTCCTGATACTCGAGTATCAGGAATATGAATCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006568.1-550s1c1
Sequence:CCGGGCGCTATTGACCTTAGCTGATCTCGAGATCAGCTAAGGTCAATAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006568.1-950s1c1
Sequence:CCGGGCAGGCAGTTTGTTCAGGAATCTCGAGATTCCTGAACAAACTGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026832
VALIDATED
CGRRF1 MISSION shRNA Bacterial Glycerol Stock
cell growth regulator with ring finger domain 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026832.2-1043s1c1
Sequence:CCGGAGCCGGAAAGTGTACTTTCTACTCGAGTAGAAAGTACACTTTCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026832.2-497s1c1
Sequence:CCGGCCAAGTGATACTGAAATTGAACTCGAGTTCAATTTCAGTATCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026832.2-240s1c1
Sequence:CCGGGCTTGGAGATCACTAATTCATCTCGAGATGAATTAGTGATCTCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026832.2-491s1c1
Sequence:CCGGCAGTTACCAAGTGATACTGAACTCGAGTTCAGTATCACTTGGTAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026832.2-61s1c1
Sequence:CCGGCTATGAATACTCGCCGCTCTTCTCGAGAAGAGCGGCGAGTATTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026832
VALIDATED
CGRRF1 MISSION shRNA shRNA Plasmid DNA
cell growth regulator with ring finger domain 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026832.2-1043s1c1
Sequence:CCGGAGCCGGAAAGTGTACTTTCTACTCGAGTAGAAAGTACACTTTCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026832.2-497s1c1
Sequence:CCGGCCAAGTGATACTGAAATTGAACTCGAGTTCAATTTCAGTATCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026832.2-240s1c1
Sequence:CCGGGCTTGGAGATCACTAATTCATCTCGAGATGAATTAGTGATCTCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026832.2-491s1c1
Sequence:CCGGCAGTTACCAAGTGATACTGAACTCGAGTTCAGTATCACTTGGTAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026832.2-61s1c1
Sequence:CCGGCTATGAATACTCGCCGCTCTTCTCGAGAAGAGCGGCGAGTATTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026832
VALIDATED
CGRRF1 MISSION shRNA Lentiviral Transduction Particles
cell growth regulator with ring finger domain 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026832.2-1043s1c1
Sequence:CCGGAGCCGGAAAGTGTACTTTCTACTCGAGTAGAAAGTACACTTTCCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026832.2-497s1c1
Sequence:CCGGCCAAGTGATACTGAAATTGAACTCGAGTTCAATTTCAGTATCACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026832.2-240s1c1
Sequence:CCGGGCTTGGAGATCACTAATTCATCTCGAGATGAATTAGTGATCTCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026832.2-491s1c1
Sequence:CCGGCAGTTACCAAGTGATACTGAACTCGAGTTCAGTATCACTTGGTAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026832.2-61s1c1
Sequence:CCGGCTATGAATACTCGCCGCTCTTCTCGAGAAGAGCGGCGAGTATTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)