EMAIL THIS PAGE TO A FRIEND

CH25H

cholesterol 25-hydroxylase

56 Gene Product Result for
Synonyms: C25H
UniProtKB ID: O95992, B2RBY3
Gene ID:
Human(9023) Summary: This is an intronless gene that is involved in cholesterol and lipid metabolism. The encoded protein is a membrane protein and contains clusters of histidine residues essential for catalytic activity. Unlike most other sterol hydroxylases, this enzyme is a member of a small family of enzymes that utilize diiron cofactors to catalyze the hydroxylation of hydrophobic substrates. [provided by RefSeq, Jul 2008]
Mouse(12642) cholesterol 25-hydroxylase
Rat(309527) cholesterol 25-hydroxylase
Zebrafish(494109) cholesterol 25-hydroxylase
domestic cat(101098893) cholesterol 25-hydroxylase
cow(506132) cholesterol 25-hydroxylase
dog(486470) cholesterol 25-hydroxylase
chicken(423788) cholesterol 25-hydroxylase
naked mole-rat(101713638) cholesterol 25-hydroxylase
domestic guinea pig(100726955) cholesterol 25-hydroxylase
sheep(101121645) cholesterol 25-hydroxylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1403010 Monoclonal Anti-CH25H antibody produced in mouse clone 1G8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003956 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053861 MISSION® esiRNA esiRNA human CH25H (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003956 Rosetta Predictions human pricing
NM_001025415 Rosetta Predictions rat pricing
NM_009890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041297 predicted 928
2 SASI_Hs01_00041298 predicted 865
3 SASI_Hs01_00041301 predicted 748
4 SASI_Hs02_00336627 predicted 999
5 SASI_Hs01_00041302 predicted 296
6 SASI_Hs01_00041304 predicted 1105
7 SASI_Hs01_00041305 predicted 1012
8 SASI_Hs01_00041306 predicted 900
9 SASI_Hs02_00336628 predicted 762
10 SASI_Hs02_00336629 predicted 537
11 SASI_Hs01_00041299 predicted 885
12 SASI_Hs01_00041300 predicted 228
13 SASI_Hs01_00041303 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025415 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051424 predicted 1073
2 SASI_Rn01_00051425 predicted 585
3 SASI_Rn01_00051427 predicted 973
4 SASI_Rn01_00051428 predicted 723
5 SASI_Rn02_00203151 predicted 204
6 SASI_Rn01_00051430 predicted 228
7 SASI_Rn01_00051431 predicted 1050
8 SASI_Rn01_00051432 predicted 849
9 SASI_Rn01_00051433 predicted 885
10 SASI_Rn02_00203152 predicted 1082
11 SASI_Rn01_00051426 predicted 423
12 SASI_Rn01_00051429 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124180 predicted 227
2 SASI_Mm01_00124181 predicted 215
3 SASI_Mm01_00124182 predicted 726
4 SASI_Mm01_00124183 predicted 606
5 SASI_Mm01_00124184 predicted 1041
6 SASI_Mm01_00124185 predicted 901
7 SASI_Mm01_00124186 predicted 1083
8 SASI_Mm01_00124187 predicted 1120
9 SASI_Mm01_00124188 predicted 619
10 SASI_Mm02_00317389 predicted 374
11 SASI_Mm01_00124179 predicted 1123
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009890
CH25H MISSION shRNA Bacterial Glycerol Stock
cholesterol 25-hydroxylase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009890.1-1088s1c1
Sequence:CCGGGCGTGGTGTATTTGAATCATTCTCGAGAATGATTCAAATACACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009890.1-598s1c1
Sequence:CCGGCCACTCACCATCTTTACCTTTCTCGAGAAAGGTAAAGATGGTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009890.1-870s1c1
Sequence:CCGGCGCTGTACACTTGATCCAGAACTCGAGTTCTGGATCAAGTGTACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009890.1-469s1c1
Sequence:CCGGCGCACCTTCCACAAGGTGCATCTCGAGATGCACCTTGTGGAAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009890.1-727s1c1
Sequence:CCGGGACATGCATCACTCTCAGTTTCTCGAGAAACTGAGAGTGATGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009890
CH25H MISSION shRNA shRNA Plasmid DNA
cholesterol 25-hydroxylase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009890.1-1088s1c1
Sequence:CCGGGCGTGGTGTATTTGAATCATTCTCGAGAATGATTCAAATACACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009890.1-598s1c1
Sequence:CCGGCCACTCACCATCTTTACCTTTCTCGAGAAAGGTAAAGATGGTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009890.1-870s1c1
Sequence:CCGGCGCTGTACACTTGATCCAGAACTCGAGTTCTGGATCAAGTGTACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009890.1-469s1c1
Sequence:CCGGCGCACCTTCCACAAGGTGCATCTCGAGATGCACCTTGTGGAAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009890.1-727s1c1
Sequence:CCGGGACATGCATCACTCTCAGTTTCTCGAGAAACTGAGAGTGATGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009890
CH25H MISSION shRNA Lentiviral Transduction Particles
cholesterol 25-hydroxylase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009890.1-1088s1c1
Sequence:CCGGGCGTGGTGTATTTGAATCATTCTCGAGAATGATTCAAATACACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009890.1-598s1c1
Sequence:CCGGCCACTCACCATCTTTACCTTTCTCGAGAAAGGTAAAGATGGTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009890.1-870s1c1
Sequence:CCGGCGCTGTACACTTGATCCAGAACTCGAGTTCTGGATCAAGTGTACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009890.1-469s1c1
Sequence:CCGGCGCACCTTCCACAAGGTGCATCTCGAGATGCACCTTGTGGAAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009890.1-727s1c1
Sequence:CCGGGACATGCATCACTCTCAGTTTCTCGAGAAACTGAGAGTGATGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003956
CH25H MISSION shRNA Bacterial Glycerol Stock
cholesterol 25-hydroxylase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003956.2-877s1c1
Sequence:CCGGGCTGTGCCTTTCACACTTGAACTCGAGTTCAAGTGTGAAAGGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003956.2-751s1c1
Sequence:CCGGCTCTCACTTTAACTGCAACTTCTCGAGAAGTTGCAGTTAAAGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003956.2-296s1c1
Sequence:CCGGCTCTACCAGCATGTGATGTTTCTCGAGAAACATCACATGCTGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003956.2-118s1c1
Sequence:CCGGCCTCCTACAGTCGCCCTTCTTCTCGAGAAGAAGGGCGACTGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003956.2-418s1c1
Sequence:CCGGGCTACTCTTCGACATGGAGTTCTCGAGAACTCCATGTCGAAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003956.3-522s21c1
Sequence:CCGGTCGCGCTGGCAACGCAGTATACTCGAGTATACTGCGTTGCCAGCGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003956.3-1103s21c1
Sequence:CCGGAGACATTCATCACTGGCATATCTCGAGATATGCCAGTGATGAATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003956.3-901s21c1
Sequence:CCGGAGAGAAACACCTGAGCTATATCTCGAGATATAGCTCAGGTGTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003956.3-1059s21c1
Sequence:CCGGTTAGTCTAGCTCACCTCAATACTCGAGTATTGAGGTGAGCTAGACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003956
CH25H MISSION shRNA shRNA Plasmid DNA
cholesterol 25-hydroxylase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003956.2-877s1c1
Sequence:CCGGGCTGTGCCTTTCACACTTGAACTCGAGTTCAAGTGTGAAAGGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003956.2-751s1c1
Sequence:CCGGCTCTCACTTTAACTGCAACTTCTCGAGAAGTTGCAGTTAAAGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003956.2-296s1c1
Sequence:CCGGCTCTACCAGCATGTGATGTTTCTCGAGAAACATCACATGCTGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003956.2-118s1c1
Sequence:CCGGCCTCCTACAGTCGCCCTTCTTCTCGAGAAGAAGGGCGACTGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003956.2-418s1c1
Sequence:CCGGGCTACTCTTCGACATGGAGTTCTCGAGAACTCCATGTCGAAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003956.3-522s21c1
Sequence:CCGGTCGCGCTGGCAACGCAGTATACTCGAGTATACTGCGTTGCCAGCGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003956.3-1103s21c1
Sequence:CCGGAGACATTCATCACTGGCATATCTCGAGATATGCCAGTGATGAATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003956.3-901s21c1
Sequence:CCGGAGAGAAACACCTGAGCTATATCTCGAGATATAGCTCAGGTGTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003956.3-1059s21c1
Sequence:CCGGTTAGTCTAGCTCACCTCAATACTCGAGTATTGAGGTGAGCTAGACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003956
CH25H MISSION shRNA Lentiviral Transduction Particles
cholesterol 25-hydroxylase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003956.2-877s1c1
Sequence:CCGGGCTGTGCCTTTCACACTTGAACTCGAGTTCAAGTGTGAAAGGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003956.2-751s1c1
Sequence:CCGGCTCTCACTTTAACTGCAACTTCTCGAGAAGTTGCAGTTAAAGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003956.2-296s1c1
Sequence:CCGGCTCTACCAGCATGTGATGTTTCTCGAGAAACATCACATGCTGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003956.2-118s1c1
Sequence:CCGGCCTCCTACAGTCGCCCTTCTTCTCGAGAAGAAGGGCGACTGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003956.2-418s1c1
Sequence:CCGGGCTACTCTTCGACATGGAGTTCTCGAGAACTCCATGTCGAAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003956.3-522s21c1
Sequence:CCGGTCGCGCTGGCAACGCAGTATACTCGAGTATACTGCGTTGCCAGCGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003956.3-1103s21c1
Sequence:CCGGAGACATTCATCACTGGCATATCTCGAGATATGCCAGTGATGAATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003956.3-901s21c1
Sequence:CCGGAGAGAAACACCTGAGCTATATCTCGAGATATAGCTCAGGTGTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003956.3-1059s21c1
Sequence:CCGGTTAGTCTAGCTCACCTCAATACTCGAGTATTGAGGTGAGCTAGACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks