EMAIL THIS PAGE TO A FRIEND

CHAC1

ChaC, cation transport regulator homolog 1 (E. coli)

77 Gene Product Result for
UniProtKB ID: Q9BUX1, Q0VIA0
Gene ID:
Mouse(69065) ChaC, cation transport regulator 1
Rat(362196) ChaC, cation transport regulator homolog 1 (E. coli)
naked mole-rat(101721673) ChaC, cation transport regulator homolog 1 (E. coli)
domestic guinea pig(100731769) ChaC, cation transport regulator homolog 1 (E. coli)
sheep(101114872) ChaC, cation transport regulator homolog 1 (E. coli)
Zebrafish(563855) ChaC, cation transport regulator-like 1
cow(505991) ChaC, cation transport regulator homolog 1 (E. coli)
domestic cat(101085130) ChaC, cation transport regulator homolog 1 (E. coli)
dog(487504) ChaC, cation transport regulator homolog 1 (E. coli)
chicken(423209) ChaC, cation transport regulator homolog 1 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026929 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026929 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026929 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024111 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024111 Rosetta Predictions human pricing
XM_001080834 Rosetta Predictions rat pricing
XM_342497 Rosetta Predictions rat pricing
NM_026929 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146246 predicted 602
2 SASI_Hs01_00146247 predicted 936
3 SASI_Hs01_00146249 predicted 450
4 SASI_Hs01_00146250 predicted 274
5 SASI_Hs01_00146251 predicted 592
6 SASI_Hs01_00146252 predicted 1115
7 SASI_Hs01_00146253 predicted 921
8 SASI_Hs01_00146254 predicted 1034
9 SASI_Hs01_00146255 predicted 439
10 SASI_Hs02_00356604 predicted 819
11 SASI_Hs01_00146248 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369579 predicted 1117
2 SASI_Rn02_00369580 predicted 916
3 SASI_Rn02_00369581 predicted 249
4 SASI_Rn02_00369582 predicted 751
5 SASI_Rn02_00369583 predicted 627
6 SASI_Rn02_00369584 predicted 642
7 SASI_Rn02_00369585 predicted 929
8 SASI_Rn02_00369586 predicted 536
9 SASI_Rn02_00369587 predicted 571
10 SASI_Rn02_00369588 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394379 predicted 751
2 SASI_Rn02_00394380 predicted 627
3 SASI_Rn02_00394381 predicted 743
4 SASI_Rn02_00394382 predicted 645
5 SASI_Rn02_00394383 predicted 535
6 SASI_Rn02_00394384 predicted 641
7 SASI_Rn02_00394385 predicted 580
8 SASI_Rn02_00394386 predicted 758
9 SASI_Rn02_00394387 predicted 534
10 SASI_Rn02_00394388 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176850 predicted 277
2 SASI_Mm01_00176851 predicted 661
3 SASI_Mm02_00331224 predicted 1301
4 SASI_Mm01_00176852 predicted 468
5 SASI_Mm01_00176853 predicted 675
6 SASI_Mm01_00176854 predicted 366
7 SASI_Mm01_00176855 predicted 674
8 SASI_Mm01_00176856 predicted 387
9 SASI_Mm01_00176858 predicted 513
10 SASI_Mm02_00331225 predicted 297
11 SASI_Mm01_00176857 predicted 1270
12 SASI_Mm01_00176859 predicted 624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026929
VALIDATED
CHAC1 MISSION shRNA Bacterial Glycerol Stock
ChaC, cation transport regulator homolog 1 (E. coli)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026929.4-1008s21c1
Sequence:CCGGTACTCACTACTTGAACCTTTACTCGAGTAAAGGTTCAAGTAGTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026929.4-325s21c1
Sequence:CCGGTGGGCTTCGTTCGTGGCTATACTCGAGTATAGCCACGAACGAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026929.4-284s21c1
Sequence:CCGGCCTAGTGTGGAAGCCGGACTTCTCGAGAAGTCCGGCTTCCACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026929.4-689s21c1
Sequence:CCGGCCTTGAGTACTTATTGCGTTTCTCGAGAAACGCAATAAGTACTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026929.4-528s21c1
Sequence:CCGGGACACTAAGGAAGTCACCTTTCTCGAGAAAGGTGACTTCCTTAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026929.2-1104s1c1
Sequence:CCGGCCTCTGGTATGTAACCAGAATCTCGAGATTCTGGTTACATACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026929.2-675s1c1
Sequence:CCGGCCTTGAGTACTTATTGCGTTTCTCGAGAAACGCAATAAGTACTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026929.2-514s1c1
Sequence:CCGGGACACTAAGGAAGTCACCTTTCTCGAGAAAGGTGACTTCCTTAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026929.2-745s1c1
Sequence:CCGGGAAGCCATTGTGGACGCCGTACTCGAGTACGGCGTCCACAATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026929.2-270s1c1
Sequence:CCGGCCTAGTGTGGAAGCCGGACTTCTCGAGAAGTCCGGCTTCCACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026929
VALIDATED
CHAC1 MISSION shRNA shRNA Plasmid DNA
ChaC, cation transport regulator homolog 1 (E. coli)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026929.4-1008s21c1
Sequence:CCGGTACTCACTACTTGAACCTTTACTCGAGTAAAGGTTCAAGTAGTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026929.4-325s21c1
Sequence:CCGGTGGGCTTCGTTCGTGGCTATACTCGAGTATAGCCACGAACGAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026929.4-284s21c1
Sequence:CCGGCCTAGTGTGGAAGCCGGACTTCTCGAGAAGTCCGGCTTCCACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026929.4-689s21c1
Sequence:CCGGCCTTGAGTACTTATTGCGTTTCTCGAGAAACGCAATAAGTACTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026929.4-528s21c1
Sequence:CCGGGACACTAAGGAAGTCACCTTTCTCGAGAAAGGTGACTTCCTTAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026929.2-1104s1c1
Sequence:CCGGCCTCTGGTATGTAACCAGAATCTCGAGATTCTGGTTACATACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026929.2-675s1c1
Sequence:CCGGCCTTGAGTACTTATTGCGTTTCTCGAGAAACGCAATAAGTACTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026929.2-514s1c1
Sequence:CCGGGACACTAAGGAAGTCACCTTTCTCGAGAAAGGTGACTTCCTTAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026929.2-745s1c1
Sequence:CCGGGAAGCCATTGTGGACGCCGTACTCGAGTACGGCGTCCACAATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026929.2-270s1c1
Sequence:CCGGCCTAGTGTGGAAGCCGGACTTCTCGAGAAGTCCGGCTTCCACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026929
VALIDATED
CHAC1 MISSION shRNA Lentiviral Transduction Particles
ChaC, cation transport regulator homolog 1 (E. coli)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026929.4-1008s21c1
Sequence:CCGGTACTCACTACTTGAACCTTTACTCGAGTAAAGGTTCAAGTAGTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026929.4-325s21c1
Sequence:CCGGTGGGCTTCGTTCGTGGCTATACTCGAGTATAGCCACGAACGAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026929.4-284s21c1
Sequence:CCGGCCTAGTGTGGAAGCCGGACTTCTCGAGAAGTCCGGCTTCCACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026929.4-689s21c1
Sequence:CCGGCCTTGAGTACTTATTGCGTTTCTCGAGAAACGCAATAAGTACTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026929.4-528s21c1
Sequence:CCGGGACACTAAGGAAGTCACCTTTCTCGAGAAAGGTGACTTCCTTAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026929.2-1104s1c1
Sequence:CCGGCCTCTGGTATGTAACCAGAATCTCGAGATTCTGGTTACATACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026929.2-675s1c1
Sequence:CCGGCCTTGAGTACTTATTGCGTTTCTCGAGAAACGCAATAAGTACTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026929.2-514s1c1
Sequence:CCGGGACACTAAGGAAGTCACCTTTCTCGAGAAAGGTGACTTCCTTAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026929.2-745s1c1
Sequence:CCGGGAAGCCATTGTGGACGCCGTACTCGAGTACGGCGTCCACAATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026929.2-270s1c1
Sequence:CCGGCCTAGTGTGGAAGCCGGACTTCTCGAGAAGTCCGGCTTCCACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024111
VALIDATED
CHAC1 MISSION shRNA Bacterial Glycerol Stock
ChaC, cation transport regulator homolog 1 (E. coli)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024111.3-671s21c1
Sequence:CCGGCCTTGAATACTTGCTGCGTCTCTCGAGAGACGCAGCAAGTATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024111.3-470s21c1
Sequence:CCGGGAAGTACCTGAATGTGCGAGACTCGAGTCTCGCACATTCAGGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024111.3-514s21c1
Sequence:CCGGCCAAGGAGGTCACCTTCTATCCTCGAGGATAGAAGGTGACCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024111.3-992s21c1
Sequence:CCGGGACTTACTACTTGAAACTTTACTCGAGTAAAGTTTCAAGTAGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024111.2-1358s1c1
Sequence:CCGGCCTCTGTCTGTCTGTCTATCTCTCGAGAGATAGACAGACAGACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024111.2-610s1c1
Sequence:CCGGCCACAACCTTGAATACTTGCTCTCGAGAGCAAGTATTCAAGGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156285    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024111.2-1034s1c1
Sequence:CCGGCATCCTGGAACTTGACCAGATCTCGAGATCTGGTCAAGTTCCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024111.2-616s1c1
Sequence:CCGGCCTTGAATACTTGCTGCGTCTCTCGAGAGACGCAGCAAGTATTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024111.2-335s1c1
Sequence:CCGGGTGACGCTCCTTGAAGATCATCTCGAGATGATCTTCAAGGAGCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024111.2-415s1c1
Sequence:CCGGGAAGTACCTGAATGTGCGAGACTCGAGTCTCGCACATTCAGGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024111.2-1329s1c1
Sequence:CCGGCCTCTTACCCACTTGGTTGTTCTCGAGAACAACCAAGTGGGTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024111
VALIDATED
CHAC1 MISSION shRNA shRNA Plasmid DNA
ChaC, cation transport regulator homolog 1 (E. coli)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024111.3-671s21c1
Sequence:CCGGCCTTGAATACTTGCTGCGTCTCTCGAGAGACGCAGCAAGTATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024111.3-470s21c1
Sequence:CCGGGAAGTACCTGAATGTGCGAGACTCGAGTCTCGCACATTCAGGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024111.3-514s21c1
Sequence:CCGGCCAAGGAGGTCACCTTCTATCCTCGAGGATAGAAGGTGACCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024111.3-992s21c1
Sequence:CCGGGACTTACTACTTGAAACTTTACTCGAGTAAAGTTTCAAGTAGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024111.2-1358s1c1
Sequence:CCGGCCTCTGTCTGTCTGTCTATCTCTCGAGAGATAGACAGACAGACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024111.2-610s1c1
Sequence:CCGGCCACAACCTTGAATACTTGCTCTCGAGAGCAAGTATTCAAGGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156285    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024111.2-1034s1c1
Sequence:CCGGCATCCTGGAACTTGACCAGATCTCGAGATCTGGTCAAGTTCCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024111.2-616s1c1
Sequence:CCGGCCTTGAATACTTGCTGCGTCTCTCGAGAGACGCAGCAAGTATTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024111.2-335s1c1
Sequence:CCGGGTGACGCTCCTTGAAGATCATCTCGAGATGATCTTCAAGGAGCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024111.2-415s1c1
Sequence:CCGGGAAGTACCTGAATGTGCGAGACTCGAGTCTCGCACATTCAGGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024111.2-1329s1c1
Sequence:CCGGCCTCTTACCCACTTGGTTGTTCTCGAGAACAACCAAGTGGGTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024111
VALIDATED
CHAC1 MISSION shRNA Lentiviral Transduction Particles
ChaC, cation transport regulator homolog 1 (E. coli)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024111.3-671s21c1
Sequence:CCGGCCTTGAATACTTGCTGCGTCTCTCGAGAGACGCAGCAAGTATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024111.3-470s21c1
Sequence:CCGGGAAGTACCTGAATGTGCGAGACTCGAGTCTCGCACATTCAGGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024111.3-514s21c1
Sequence:CCGGCCAAGGAGGTCACCTTCTATCCTCGAGGATAGAAGGTGACCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024111.3-992s21c1
Sequence:CCGGGACTTACTACTTGAAACTTTACTCGAGTAAAGTTTCAAGTAGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156494    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024111.2-1358s1c1
Sequence:CCGGCCTCTGTCTGTCTGTCTATCTCTCGAGAGATAGACAGACAGACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024111.2-610s1c1
Sequence:CCGGCCACAACCTTGAATACTTGCTCTCGAGAGCAAGTATTCAAGGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156285    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024111.2-1034s1c1
Sequence:CCGGCATCCTGGAACTTGACCAGATCTCGAGATCTGGTCAAGTTCCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024111.2-616s1c1
Sequence:CCGGCCTTGAATACTTGCTGCGTCTCTCGAGAGACGCAGCAAGTATTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024111.2-335s1c1
Sequence:CCGGGTGACGCTCCTTGAAGATCATCTCGAGATGATCTTCAAGGAGCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024111.2-415s1c1
Sequence:CCGGGAAGTACCTGAATGTGCGAGACTCGAGTCTCGCACATTCAGGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_024111.2-1329s1c1
Sequence:CCGGCCTCTTACCCACTTGGTTGTTCTCGAGAACAACCAAGTGGGTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks