EMAIL THIS PAGE TO A FRIEND

CHAC2

ChaC, cation transport regulator homolog 2 (E. coli)

58 Gene Product Result for
UniProtKB ID: Q8WUX2, Q8WVI8
Gene ID:
Mouse(68044) ChaC, cation transport regulator 2
Rat(360994) ChaC, cation transport regulator homolog 2 (E. coli)
Zebrafish(557614) ChaC, cation transport regulator homolog 2 (E. coli)
chicken(421221) ChaC, cation transport regulator homolog 2 (E. coli)
cow(511605) ChaC, cation transport regulator homolog 2 (E. coli)
domestic cat(101089182) ChaC, cation transport regulator homolog 2 (E. coli)
dog(612017) ChaC, cation transport regulator homolog 2 (E. coli)
sheep(101104387) ChaC, cation transport regulator homolog 2 (E. coli)
domestic guinea pig(100716588) ChaC, cation transport regulator homolog 2 (E. coli)
naked mole-rat(101716029) ChaC, cation transport regulator homolog 2 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008708 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026527 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026527 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026527 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU066681 MISSION® esiRNA esiRNA targeting mouse Chac2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008708 Rosetta Predictions human pricing
NM_001025016 Rosetta Predictions rat pricing
XM_001054484 Rosetta Predictions rat pricing
NM_026527 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237816 predicted 408
2 SASI_Hs01_00237817 predicted 867
3 SASI_Hs01_00237818 predicted 761
4 SASI_Hs01_00237819 predicted 757
5 SASI_Hs01_00237820 predicted 230
6 SASI_Hs01_00237821 predicted 605
7 SASI_Hs01_00237822 predicted 668
8 SASI_Hs01_00237823 predicted 425
9 SASI_Hs01_00237824 predicted 632
10 SASI_Hs01_00237825 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091680 predicted 463
2 SASI_Rn02_00202923 predicted 207
3 SASI_Rn02_00202924 predicted 459
4 SASI_Rn02_00202925 predicted 202
5 SASI_Rn02_00202926 predicted 662
6 SASI_Rn02_00202927 predicted 190
7 SASI_Rn02_00202928 predicted 146
8 SASI_Rn01_00091681 predicted 373
9 SASI_Rn01_00091682 predicted 488
10 SASI_Rn01_00091683 predicted 233
11 SASI_Rn01_00091684 predicted 443
12 SASI_Rn01_00091685 predicted 456
13 SASI_Rn01_00091686 predicted 266
14 SASI_Rn01_00091687 predicted 265
15 SASI_Rn01_00091688 predicted 485
16 SASI_Rn01_00091689 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054484 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275968 predicted 459
2 SASI_Rn02_00275969 predicted 502
3 SASI_Rn02_00275970 predicted 503
4 SASI_Rn02_00275971 predicted 495
5 SASI_Rn02_00275972 predicted 495
6 SASI_Rn02_00275973 predicted 709
7 SASI_Rn02_00275974 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026527 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330439 predicted 843
2 SASI_Mm01_00159557 predicted 887
3 SASI_Mm02_00330440 predicted 829
4 SASI_Mm01_00159558 predicted 851
5 SASI_Mm01_00159560 predicted 494
6 SASI_Mm01_00159562 predicted 725
7 SASI_Mm01_00159563 predicted 784
8 SASI_Mm01_00159564 predicted 784
9 SASI_Mm01_00159565 predicted 916
10 SASI_Mm01_00159566 predicted 442
11 SASI_Mm01_00159559 predicted 904
12 SASI_Mm01_00159561 predicted 848
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008708
CHAC2 MISSION shRNA Bacterial Glycerol Stock
ChaC, cation transport regulator homolog 2 (E. coli)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-466s1c1
Sequence:CCGGCCTCTGGAAGACATTGCTGAACTCGAGTTCAGCAATGTCTTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008708.1-356s1c1
Sequence:CCGGGCTACAGAACCACAACAGTCACTCGAGTGACTGTTGTGGTTCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-502s1c1
Sequence:CCGGGCTGGTCCAAGTGGAAGAAATCTCGAGATTTCTTCCACTTGGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-445s1c1
Sequence:CCGGCCTGATTATCTTGGTCCTGCACTCGAGTGCAGGACCAAGATAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-568s1c1
Sequence:CCGGCCAGAAGAAGCAGATGAGCATCTCGAGATGCTCATCTGCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-625s1c1
Sequence:CCGGGAAGGGAAACAGAACCTCAATCTCGAGATTGAGGTTCTGTTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008708.1-301s1c1
Sequence:CCGGCCAGTAGGAAAGGAAGAAGAACTCGAGTTCTTCTTCCTTTCCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008708.1-949s1c1
Sequence:CCGGCATCCTGTTTCACATCCCAATCTCGAGATTGGGATGTGAAACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-328s1c1
Sequence:CCGGGCATACCTTGACTTCAGAGAACTCGAGTTCTCTGAAGTCAAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008708.1-953s1c1
Sequence:CCGGCTGTTTCACATCCCAATACTACTCGAGTAGTATTGGGATGTGAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151711    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008708.1-937s1c1
Sequence:CCGGCAGAGTGATAATCATCCTGTTCTCGAGAACAGGATGATTATCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008708
CHAC2 MISSION shRNA shRNA Plasmid DNA
ChaC, cation transport regulator homolog 2 (E. coli)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-466s1c1
Sequence:CCGGCCTCTGGAAGACATTGCTGAACTCGAGTTCAGCAATGTCTTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008708.1-356s1c1
Sequence:CCGGGCTACAGAACCACAACAGTCACTCGAGTGACTGTTGTGGTTCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-502s1c1
Sequence:CCGGGCTGGTCCAAGTGGAAGAAATCTCGAGATTTCTTCCACTTGGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-445s1c1
Sequence:CCGGCCTGATTATCTTGGTCCTGCACTCGAGTGCAGGACCAAGATAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-568s1c1
Sequence:CCGGCCAGAAGAAGCAGATGAGCATCTCGAGATGCTCATCTGCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-625s1c1
Sequence:CCGGGAAGGGAAACAGAACCTCAATCTCGAGATTGAGGTTCTGTTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008708.1-301s1c1
Sequence:CCGGCCAGTAGGAAAGGAAGAAGAACTCGAGTTCTTCTTCCTTTCCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008708.1-949s1c1
Sequence:CCGGCATCCTGTTTCACATCCCAATCTCGAGATTGGGATGTGAAACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-328s1c1
Sequence:CCGGGCATACCTTGACTTCAGAGAACTCGAGTTCTCTGAAGTCAAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008708.1-953s1c1
Sequence:CCGGCTGTTTCACATCCCAATACTACTCGAGTAGTATTGGGATGTGAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151711    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008708.1-937s1c1
Sequence:CCGGCAGAGTGATAATCATCCTGTTCTCGAGAACAGGATGATTATCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008708
CHAC2 MISSION shRNA Lentiviral Transduction Particles
ChaC, cation transport regulator homolog 2 (E. coli)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-466s1c1
Sequence:CCGGCCTCTGGAAGACATTGCTGAACTCGAGTTCAGCAATGTCTTCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008708.1-356s1c1
Sequence:CCGGGCTACAGAACCACAACAGTCACTCGAGTGACTGTTGTGGTTCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-502s1c1
Sequence:CCGGGCTGGTCCAAGTGGAAGAAATCTCGAGATTTCTTCCACTTGGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-445s1c1
Sequence:CCGGCCTGATTATCTTGGTCCTGCACTCGAGTGCAGGACCAAGATAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-568s1c1
Sequence:CCGGCCAGAAGAAGCAGATGAGCATCTCGAGATGCTCATCTGCTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-625s1c1
Sequence:CCGGGAAGGGAAACAGAACCTCAATCTCGAGATTGAGGTTCTGTTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008708.1-301s1c1
Sequence:CCGGCCAGTAGGAAAGGAAGAAGAACTCGAGTTCTTCTTCCTTTCCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008708.1-949s1c1
Sequence:CCGGCATCCTGTTTCACATCCCAATCTCGAGATTGGGATGTGAAACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008708.1-328s1c1
Sequence:CCGGGCATACCTTGACTTCAGAGAACTCGAGTTCTCTGAAGTCAAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008708.1-953s1c1
Sequence:CCGGCTGTTTCACATCCCAATACTACTCGAGTAGTATTGGGATGTGAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151711    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008708.1-937s1c1
Sequence:CCGGCAGAGTGATAATCATCCTGTTCTCGAGAACAGGATGATTATCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026527
VALIDATED
CHAC2 MISSION shRNA Bacterial Glycerol Stock
ChaC, cation transport regulator homolog 2 (E. coli)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026527.1-347s1c1
Sequence:CCGGCTACAGAACTACGACAGTCATCTCGAGATGACTGTCGTAGTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026527.1-149s1c1
Sequence:CCGGGCTGGTTGGTTACATCACAAACTCGAGTTTGTGATGTAACCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026527.1-800s1c1
Sequence:CCGGCCTGAAACATATCCAACAGATCTCGAGATCTGTTGGATATGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026527.1-450s1c1
Sequence:CCGGCCTGCACCTCTGGAAGATATTCTCGAGAATATCTTCCAGAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026527.1-543s1c1
Sequence:CCGGGTTAGGAAACTTGTACCAGAACTCGAGTTCTGGTACAAGTTTCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026527.2-377s21c1
Sequence:CCGGCTACAGAACTACGACAGTCATCTCGAGATGACTGTCGTAGTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026527.2-179s21c1
Sequence:CCGGGCTGGTTGGTTACATCACAAACTCGAGTTTGTGATGTAACCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026527.2-830s21c1
Sequence:CCGGCCTGAAACATATCCAACAGATCTCGAGATCTGTTGGATATGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026527.2-480s21c1
Sequence:CCGGCCTGCACCTCTGGAAGATATTCTCGAGAATATCTTCCAGAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026527
VALIDATED
CHAC2 MISSION shRNA shRNA Plasmid DNA
ChaC, cation transport regulator homolog 2 (E. coli)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026527.1-347s1c1
Sequence:CCGGCTACAGAACTACGACAGTCATCTCGAGATGACTGTCGTAGTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026527.1-149s1c1
Sequence:CCGGGCTGGTTGGTTACATCACAAACTCGAGTTTGTGATGTAACCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026527.1-800s1c1
Sequence:CCGGCCTGAAACATATCCAACAGATCTCGAGATCTGTTGGATATGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026527.1-450s1c1
Sequence:CCGGCCTGCACCTCTGGAAGATATTCTCGAGAATATCTTCCAGAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026527.1-543s1c1
Sequence:CCGGGTTAGGAAACTTGTACCAGAACTCGAGTTCTGGTACAAGTTTCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026527.2-377s21c1
Sequence:CCGGCTACAGAACTACGACAGTCATCTCGAGATGACTGTCGTAGTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026527.2-179s21c1
Sequence:CCGGGCTGGTTGGTTACATCACAAACTCGAGTTTGTGATGTAACCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026527.2-830s21c1
Sequence:CCGGCCTGAAACATATCCAACAGATCTCGAGATCTGTTGGATATGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026527.2-480s21c1
Sequence:CCGGCCTGCACCTCTGGAAGATATTCTCGAGAATATCTTCCAGAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026527
VALIDATED
CHAC2 MISSION shRNA Lentiviral Transduction Particles
ChaC, cation transport regulator homolog 2 (E. coli)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026527.1-347s1c1
Sequence:CCGGCTACAGAACTACGACAGTCATCTCGAGATGACTGTCGTAGTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026527.1-149s1c1
Sequence:CCGGGCTGGTTGGTTACATCACAAACTCGAGTTTGTGATGTAACCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026527.1-800s1c1
Sequence:CCGGCCTGAAACATATCCAACAGATCTCGAGATCTGTTGGATATGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026527.1-450s1c1
Sequence:CCGGCCTGCACCTCTGGAAGATATTCTCGAGAATATCTTCCAGAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026527.1-543s1c1
Sequence:CCGGGTTAGGAAACTTGTACCAGAACTCGAGTTCTGGTACAAGTTTCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026527.2-377s21c1
Sequence:CCGGCTACAGAACTACGACAGTCATCTCGAGATGACTGTCGTAGTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026527.2-179s21c1
Sequence:CCGGGCTGGTTGGTTACATCACAAACTCGAGTTTGTGATGTAACCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026527.2-830s21c1
Sequence:CCGGCCTGAAACATATCCAACAGATCTCGAGATCTGTTGGATATGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026527.2-480s21c1
Sequence:CCGGCCTGCACCTCTGGAAGATATTCTCGAGAATATCTTCCAGAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks