EMAIL THIS PAGE TO A FRIEND

CHAD

chondroadherin

50 Gene Product Result for
Synonyms: SLRR4A
UniProtKB ID: O15335, A8K812, Q6GTU0, Q96RJ5
Gene ID:
Human(1101) Summary: Chondroadherin is a cartilage matrix protein thought to mediate adhesion of isolated chondrocytes. The protein contains 11 leucine-rich repeats flanked by cysteine-rich regions. The chondroadherin messenger RNA is present in chondrocytes at all ages. [provided by RefSeq, Jul 2008]
Mouse(12643) chondroadherin
Rat(29195) chondroadherin
naked mole-rat(101705837) chondroadherin
Zebrafish(394038) chondroadherin
cow(281069) chondroadherin
Horse(100147607) chondroadherin
chicken(769665) chondroadherin
dog(609296) chondroadherin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001267 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007689 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007689 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007689 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001267 Rosetta Predictions human pricing
NM_019164 Rosetta Predictions rat pricing
NM_007689 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060674 predicted 335
2 SASI_Hs02_00331467 predicted 1166
3 SASI_Hs01_00060675 predicted 858
4 SASI_Hs01_00060678 predicted 843
5 SASI_Hs01_00060679 predicted 1110
6 SASI_Hs01_00060680 predicted 1125
7 SASI_Hs01_00060681 predicted 762
8 SASI_Hs02_00331468 predicted 350
9 SASI_Hs01_00060682 predicted 635
10 SASI_Hs01_00060683 predicted 1102
11 SASI_Hs01_00060676 predicted 1201
12 SASI_Hs01_00060677 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019164 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044257 predicted 399
2 SASI_Rn01_00044258 predicted 1032
3 SASI_Rn01_00044259 predicted 199
4 SASI_Rn02_00261950 predicted 1089
5 SASI_Rn01_00044260 predicted 846
6 SASI_Rn01_00044261 predicted 1113
7 SASI_Rn01_00044262 predicted 1104
8 SASI_Rn01_00044263 predicted 1363
9 SASI_Rn01_00044264 predicted 358
10 SASI_Rn01_00044265 predicted 392
11 SASI_Rn01_00044266 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137227 predicted 1002
2 SASI_Mm01_00137228 predicted 1066
3 SASI_Mm01_00137229 predicted 370
4 SASI_Mm01_00137230 predicted 1058
5 SASI_Mm01_00137231 predicted 1092
6 SASI_Mm01_00137232 predicted 367
7 SASI_Mm02_00312226 predicted 1152
8 SASI_Mm01_00137233 predicted 1087
9 SASI_Mm02_00312227 predicted 1347
10 SASI_Mm02_00312228 predicted 839
11 SASI_Mm01_00137224 predicted 199
12 SASI_Mm01_00137225 predicted 218
13 SASI_Mm01_00137226 predicted 212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001267
CHAD MISSION shRNA Bacterial Glycerol Stock
chondroadherin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001267.2-219s21c1
Sequence:CCGGCTCAACCTACAGCGCAACAACCTCGAGGTTGTTGCGCTGTAGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001267.2-272s21c1
Sequence:CCGGCATGCCGAACCTCGTGTCATTCTCGAGAATGACACGAGGTTCGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001267.2-858s1c1
Sequence:CCGGACGCTGAAACACGTCCATTTGCTCGAGCAAATGGACGTGTTTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001267.2-632s1c1
Sequence:CCGGCGTGGAGAACCTCGCCAAATTCTCGAGAATTTGGCGAGGTTCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001267.2-360s21c1
Sequence:CCGGTACTTGTACCTGTCCCATAACCTCGAGGTTATGGGACAGGTACAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001267.1-855s1c1
Sequence:CCGGGACAATGCCTTCCAGTCCTTTCTCGAGAAAGGACTGGAAGGCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001267.1-584s1c1
Sequence:CCGGGCTGGTCAACCTCTTCATCTTCTCGAGAAGATGAAGAGGTTGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178948    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001267.1-1519s1c1
Sequence:CCGGCCAAGTCAATCAGAACCACAACTCGAGTTGTGGTTCTGATTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001267
CHAD MISSION shRNA shRNA Plasmid DNA
chondroadherin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001267.2-219s21c1
Sequence:CCGGCTCAACCTACAGCGCAACAACCTCGAGGTTGTTGCGCTGTAGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001267.2-272s21c1
Sequence:CCGGCATGCCGAACCTCGTGTCATTCTCGAGAATGACACGAGGTTCGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001267.2-858s1c1
Sequence:CCGGACGCTGAAACACGTCCATTTGCTCGAGCAAATGGACGTGTTTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001267.2-632s1c1
Sequence:CCGGCGTGGAGAACCTCGCCAAATTCTCGAGAATTTGGCGAGGTTCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001267.2-360s21c1
Sequence:CCGGTACTTGTACCTGTCCCATAACCTCGAGGTTATGGGACAGGTACAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001267.1-855s1c1
Sequence:CCGGGACAATGCCTTCCAGTCCTTTCTCGAGAAAGGACTGGAAGGCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001267.1-584s1c1
Sequence:CCGGGCTGGTCAACCTCTTCATCTTCTCGAGAAGATGAAGAGGTTGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178948    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001267.1-1519s1c1
Sequence:CCGGCCAAGTCAATCAGAACCACAACTCGAGTTGTGGTTCTGATTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001267
CHAD MISSION shRNA Lentiviral Transduction Particles
chondroadherin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001267.2-219s21c1
Sequence:CCGGCTCAACCTACAGCGCAACAACCTCGAGGTTGTTGCGCTGTAGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001267.2-272s21c1
Sequence:CCGGCATGCCGAACCTCGTGTCATTCTCGAGAATGACACGAGGTTCGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001267.2-858s1c1
Sequence:CCGGACGCTGAAACACGTCCATTTGCTCGAGCAAATGGACGTGTTTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001267.2-632s1c1
Sequence:CCGGCGTGGAGAACCTCGCCAAATTCTCGAGAATTTGGCGAGGTTCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001267.2-360s21c1
Sequence:CCGGTACTTGTACCTGTCCCATAACCTCGAGGTTATGGGACAGGTACAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001267.1-855s1c1
Sequence:CCGGGACAATGCCTTCCAGTCCTTTCTCGAGAAAGGACTGGAAGGCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001267.1-584s1c1
Sequence:CCGGGCTGGTCAACCTCTTCATCTTCTCGAGAAGATGAAGAGGTTGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178948    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001267.1-1519s1c1
Sequence:CCGGCCAAGTCAATCAGAACCACAACTCGAGTTGTGGTTCTGATTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007689
CHAD MISSION shRNA Bacterial Glycerol Stock
chondroadherin
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007689.4-1413s21c1
Sequence:CCGGCATTGGGATGACCACGTTATTCTCGAGAATAACGTGGTCATCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007689.4-1153s21c1
Sequence:CCAGCTGACGTTCCCTCCCATTATCCTCGAGGATAATGGGAGGGAACGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007689.2-451s1c1
Sequence:CCGGGACCACAACAAAGTGTCGGAACTCGAGTTCCGACACTTTGTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007689.2-1386s1c1
Sequence:CCGGGCTCCTTTGAGAGAAGCTATTCTCGAGAATAGCTTCTCTCAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007689.2-420s1c1
Sequence:CCGGCGACCTGACTGAACTCACTTACTCGAGTAAGTGAGTTCAGTCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007689.2-751s1c1
Sequence:CCGGCTGAAGAGCATCCCAGACAATCTCGAGATTGTCTGGGATGCTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007689.2-1104s1c1
Sequence:CCGGCCCGACCAAGAGGTCCAAGAACTCGAGTTCTTGGACCTCTTGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007689
CHAD MISSION shRNA shRNA Plasmid DNA
chondroadherin
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007689.4-1413s21c1
Sequence:CCGGCATTGGGATGACCACGTTATTCTCGAGAATAACGTGGTCATCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007689.4-1153s21c1
Sequence:CCAGCTGACGTTCCCTCCCATTATCCTCGAGGATAATGGGAGGGAACGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007689.2-451s1c1
Sequence:CCGGGACCACAACAAAGTGTCGGAACTCGAGTTCCGACACTTTGTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007689.2-1386s1c1
Sequence:CCGGGCTCCTTTGAGAGAAGCTATTCTCGAGAATAGCTTCTCTCAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007689.2-420s1c1
Sequence:CCGGCGACCTGACTGAACTCACTTACTCGAGTAAGTGAGTTCAGTCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007689.2-751s1c1
Sequence:CCGGCTGAAGAGCATCCCAGACAATCTCGAGATTGTCTGGGATGCTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007689.2-1104s1c1
Sequence:CCGGCCCGACCAAGAGGTCCAAGAACTCGAGTTCTTGGACCTCTTGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007689
CHAD MISSION shRNA Lentiviral Transduction Particles
chondroadherin
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007689.4-1413s21c1
Sequence:CCGGCATTGGGATGACCACGTTATTCTCGAGAATAACGTGGTCATCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007689.4-1153s21c1
Sequence:CCAGCTGACGTTCCCTCCCATTATCCTCGAGGATAATGGGAGGGAACGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007689.2-451s1c1
Sequence:CCGGGACCACAACAAAGTGTCGGAACTCGAGTTCCGACACTTTGTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007689.2-1386s1c1
Sequence:CCGGGCTCCTTTGAGAGAAGCTATTCTCGAGAATAGCTTCTCTCAAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007689.2-420s1c1
Sequence:CCGGCGACCTGACTGAACTCACTTACTCGAGTAAGTGAGTTCAGTCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007689.2-751s1c1
Sequence:CCGGCTGAAGAGCATCCCAGACAATCTCGAGATTGTCTGGGATGCTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007689.2-1104s1c1
Sequence:CCGGCCCGACCAAGAGGTCCAAGAACTCGAGTTCTTGGACCTCTTGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks