EMAIL THIS PAGE TO A FRIEND

CHADL

chondroadherin-like

32 Gene Product Result for
Synonyms: SLRR4B
UniProtKB ID: Q6NUI6, Q05CY2, Q4G0S0, Q5JY13, Q86XY1, Q96E60
Gene ID:
Mouse(214685) chondroadherin-like
Rat(100910434) chondroadherin-like
chicken(417998) chondroadherin-like
dog(100684070) chondroadherin-like
cow(100847739) chondroadherin-like
Horse(100034030) chondroadherin-like
domestic guinea pig(100715040) chondroadherin-like
naked mole-rat(101710180) chondroadherin-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138481 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052751 MISSION® esiRNA esiRNA human CHADL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_377720 Rosetta Predictions human pricing
XM_988017 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_377720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251348 predicted 826
2 SASI_Hs01_00251349 predicted 1659
3 SASI_Hs01_00251350 predicted 735
4 SASI_Hs01_00251351 predicted 594
5 SASI_Hs01_00251352 predicted 1662
6 SASI_Hs01_00251353 predicted 2078
7 SASI_Hs01_00251354 predicted 255
8 SASI_Hs01_00251355 predicted 467
9 SASI_Hs01_00251356 predicted 1743
10 SASI_Hs01_00251357 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210457 predicted 1930
2 SASI_Mm01_00210458 predicted 1647
3 SASI_Mm01_00210459 predicted 268
4 SASI_Mm01_00210460 predicted 1657
5 SASI_Mm01_00210461 predicted 490
6 SASI_Mm01_00210462 predicted 708
7 SASI_Mm01_00210463 predicted 1287
8 SASI_Mm01_00210464 predicted 2014
9 SASI_Mm01_00210465 predicted 208
10 SASI_Mm01_00210466 predicted 1894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164320
CHADL MISSION shRNA Bacterial Glycerol Stock
chondroadherin-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-247s21c1
Sequence:CCGGCTGGACCTCCAGGGCAATATACTCGAGTATATTGCCCTGGAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-1929s21c1
Sequence:CCGGCAGTGACCTGGAGCAGATTTCCTCGAGGAAATCTGCTCCAGGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-1698s21c1
Sequence:CCGGTTACCTGAGTGGCAATCACATCTCGAGATGTGATTGCCACTCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-2186s21c1
Sequence:CCGGAGGTTGCAGCTCCTGTCTTTGCTCGAGCAAAGACAGGAGCTGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-2058s21c1
Sequence:CCGGCGACCTCAGCGGTAATCCTTTCTCGAGAAAGGATTACCGCTGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-1763s21c1
Sequence:CCGGAGAAGCTGCACCTCGACAGAACTCGAGTTCTGTCGAGGTGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164320.1-2300s21c1
Sequence:CCGGGAACAGACAAGGTAGAGAAACCTCGAGGTTTCTCTACCTTGTCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164320
CHADL MISSION shRNA shRNA Plasmid DNA
chondroadherin-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-247s21c1
Sequence:CCGGCTGGACCTCCAGGGCAATATACTCGAGTATATTGCCCTGGAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-1929s21c1
Sequence:CCGGCAGTGACCTGGAGCAGATTTCCTCGAGGAAATCTGCTCCAGGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-1698s21c1
Sequence:CCGGTTACCTGAGTGGCAATCACATCTCGAGATGTGATTGCCACTCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-2186s21c1
Sequence:CCGGAGGTTGCAGCTCCTGTCTTTGCTCGAGCAAAGACAGGAGCTGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-2058s21c1
Sequence:CCGGCGACCTCAGCGGTAATCCTTTCTCGAGAAAGGATTACCGCTGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-1763s21c1
Sequence:CCGGAGAAGCTGCACCTCGACAGAACTCGAGTTCTGTCGAGGTGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164320.1-2300s21c1
Sequence:CCGGGAACAGACAAGGTAGAGAAACCTCGAGGTTTCTCTACCTTGTCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164320
CHADL MISSION shRNA Lentiviral Transduction Particles
chondroadherin-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-247s21c1
Sequence:CCGGCTGGACCTCCAGGGCAATATACTCGAGTATATTGCCCTGGAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-1929s21c1
Sequence:CCGGCAGTGACCTGGAGCAGATTTCCTCGAGGAAATCTGCTCCAGGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-1698s21c1
Sequence:CCGGTTACCTGAGTGGCAATCACATCTCGAGATGTGATTGCCACTCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-2186s21c1
Sequence:CCGGAGGTTGCAGCTCCTGTCTTTGCTCGAGCAAAGACAGGAGCTGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-2058s21c1
Sequence:CCGGCGACCTCAGCGGTAATCCTTTCTCGAGAAAGGATTACCGCTGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164320.1-1763s21c1
Sequence:CCGGAGAAGCTGCACCTCGACAGAACTCGAGTTCTGTCGAGGTGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164320.1-2300s21c1
Sequence:CCGGGAACAGACAAGGTAGAGAAACCTCGAGGTTTCTCTACCTTGTCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138481
CHADL MISSION shRNA Bacterial Glycerol Stock
chondroadherin-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138481.1-1557s21c1
Sequence:CCGGTACCTAGAACGCAACCGTTTCCTCGAGGAAACGGTTGCGTTCTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138481.1-2292s21c1
Sequence:CCGGAGACAGTGTGGAGCAGATAAGCTCGAGCTTATCTGCTCCACACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138481.1-1479s21c1
Sequence:CCGGTACCTGTACCTCTCCGACAACCTCGAGGTTGTCGGAGAGGTACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138481.1-1932s21c1
Sequence:CCGGAGTGGCCTGGAGCAGATTTGTCTCGAGACAAATCTGCTCCAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138481.1-249s21c1
Sequence:CCGGCTGGACCTGCAGGGCAATTTGCTCGAGCAAATTGCCCTGCAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138481
CHADL MISSION shRNA shRNA Plasmid DNA
chondroadherin-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138481.1-1557s21c1
Sequence:CCGGTACCTAGAACGCAACCGTTTCCTCGAGGAAACGGTTGCGTTCTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138481.1-2292s21c1
Sequence:CCGGAGACAGTGTGGAGCAGATAAGCTCGAGCTTATCTGCTCCACACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138481.1-1479s21c1
Sequence:CCGGTACCTGTACCTCTCCGACAACCTCGAGGTTGTCGGAGAGGTACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138481.1-1932s21c1
Sequence:CCGGAGTGGCCTGGAGCAGATTTGTCTCGAGACAAATCTGCTCCAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138481.1-249s21c1
Sequence:CCGGCTGGACCTGCAGGGCAATTTGCTCGAGCAAATTGCCCTGCAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138481
CHADL MISSION shRNA Lentiviral Transduction Particles
chondroadherin-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138481.1-1557s21c1
Sequence:CCGGTACCTAGAACGCAACCGTTTCCTCGAGGAAACGGTTGCGTTCTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138481.1-2292s21c1
Sequence:CCGGAGACAGTGTGGAGCAGATAAGCTCGAGCTTATCTGCTCCACACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138481.1-1479s21c1
Sequence:CCGGTACCTGTACCTCTCCGACAACCTCGAGGTTGTCGGAGAGGTACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138481.1-1932s21c1
Sequence:CCGGAGTGGCCTGGAGCAGATTTGTCTCGAGACAAATCTGCTCCAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138481.1-249s21c1
Sequence:CCGGCTGGACCTGCAGGGCAATTTGCTCGAGCAAATTGCCCTGCAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks