EMAIL THIS PAGE TO A FRIEND

CHAF1A

chromatin assembly factor 1, subunit A (p150)

59 Gene Product Result for
Synonyms: CAF-1 CAF1 CAF1B CAF1P150 P150
UniProtKB ID: Q13111, Q6NXG5, Q7Z7K3, Q9UJY8
Gene ID:
Human(10036) Summary: Chromatin assembly factor I (CAF1) is a nuclear complex consisting of p50, p60 (CHAF1B; MIM 601245), and p150 (CHAF1A) subunits that assembles histone octamers onto replicating DNA in vitro (Kaufman et al., 1995 [PubMed 7600578]
Mouse(27221) chromatin assembly factor 1, subunit A (p150)
Rat(363333) chromatin assembly factor 1, subunit A (p150)
Zebrafish(563212) chromatin assembly factor 1, subunit A (p150)
chicken(770217) chromatin assembly factor 1, subunit A (p150)
domestic cat(101090592) chromatin assembly factor 1, subunit A (p150)
cow(504535) chromatin assembly factor 1, subunit A (p150)
dog(485038) chromatin assembly factor 1, subunit A (p150)
naked mole-rat(101699676) chromatin assembly factor 1, subunit A (p150)
domestic guinea pig(100735585) chromatin assembly factor 1, subunit A (p150)
sheep(101112053) chromatin assembly factor 1, subunit A (p150)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005483 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005483 Rosetta Predictions human pricing
XM_001061702 Rosetta Predictions rat pricing
XM_343671 Rosetta Predictions rat pricing
NM_013733 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084399 predicted 476
2 SASI_Hs01_00084400 predicted 346
3 SASI_Hs01_00084401 predicted 211
4 SASI_Hs01_00084402 predicted 205
5 SASI_Hs01_00084403 predicted 530
6 SASI_Hs01_00084404 predicted 476
7 SASI_Hs01_00084405 predicted 2146
8 SASI_Hs01_00084406 predicted 341
9 SASI_Hs01_00084408 predicted 2490
10 SASI_Hs02_00339672 predicted 333
11 SASI_Hs01_00084407 predicted 1752
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061702 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301052 predicted 607
2 SASI_Rn02_00301053 predicted 393
3 SASI_Rn02_00301054 predicted 2338
4 SASI_Rn02_00301055 predicted 1653
5 SASI_Rn02_00301056 predicted 1922
6 SASI_Rn02_00301057 predicted 2350
7 SASI_Rn02_00301058 predicted 274
8 SASI_Rn02_00301059 predicted 2737
9 SASI_Rn02_00301060 predicted 401
10 SASI_Rn02_00301061 predicted 1464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396180 predicted 477
2 SASI_Rn02_00396181 predicted 270
3 SASI_Rn02_00396182 predicted 2207
4 SASI_Rn02_00396183 predicted 1520
5 SASI_Rn02_00396184 predicted 1790
6 SASI_Rn02_00396185 predicted 2213
7 SASI_Rn02_00396186 predicted 2606
8 SASI_Rn02_00396187 predicted 270
9 SASI_Rn02_00396188 predicted 1325
10 SASI_Rn02_00396189 predicted 2610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026575 predicted 1690
2 SASI_Mm01_00026576 predicted 1991
3 SASI_Mm01_00026577 predicted 1615
4 SASI_Mm01_00026578 predicted 2363
5 SASI_Mm01_00026579 predicted 2789
6 SASI_Mm01_00026580 predicted 1682
7 SASI_Mm01_00026581 predicted 2816
8 SASI_Mm01_00026582 predicted 2410
9 SASI_Mm01_00026583 predicted 2429
10 SASI_Mm01_00026584 predicted 2608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013733
VALIDATED
CHAF1A MISSION shRNA Bacterial Glycerol Stock
chromatin assembly factor 1, subunit A (p150)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013733.3-3113s21c1
Sequence:CCGGCCTGGACAGCTACTTCCAAATCTCGAGATTTGGAAGTAGCTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013733.3-333s21c1
Sequence:CCGGCGTAGGCTTGAGTACAAAGTTCTCGAGAACTTTGTACTCAAGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013733.3-1671s21c1
Sequence:CCGGCGGTGTGTCTGAAAGGAAGAACTCGAGTTCTTCCTTTCAGACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013733.3-405s21c1
Sequence:CCGGAGTACCGAGTGTGGTCATTATCTCGAGATAATGACCACACTCGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013733.3-2642s21c1
Sequence:CCGGCCATGTGCATCACGCAGTTTACTCGAGTAAACTGCGTGATGCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013733.2-334s1c1
Sequence:CCGGCGTAGGCTTGAGTACAAAGTTCTCGAGAACTTTGTACTCAAGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013733.2-167s1c1
Sequence:CCGGCCAGTGAAGAGGTTAATACAACTCGAGTTGTATTAACCTCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013733.2-3114s1c1
Sequence:CCGGCCTGGACAGCTACTTCCAAATCTCGAGATTTGGAAGTAGCTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013733.2-1672s1c1
Sequence:CCGGCGGTGTGTCTGAAAGGAAGAACTCGAGTTCTTCCTTTCAGACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013733.2-2257s1c1
Sequence:CCGGGCTGCTACATGGCAATGTGAACTCGAGTTCACATTGCCATGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013733
VALIDATED
CHAF1A MISSION shRNA shRNA Plasmid DNA
chromatin assembly factor 1, subunit A (p150)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013733.3-3113s21c1
Sequence:CCGGCCTGGACAGCTACTTCCAAATCTCGAGATTTGGAAGTAGCTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013733.3-333s21c1
Sequence:CCGGCGTAGGCTTGAGTACAAAGTTCTCGAGAACTTTGTACTCAAGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013733.3-1671s21c1
Sequence:CCGGCGGTGTGTCTGAAAGGAAGAACTCGAGTTCTTCCTTTCAGACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013733.3-405s21c1
Sequence:CCGGAGTACCGAGTGTGGTCATTATCTCGAGATAATGACCACACTCGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013733.3-2642s21c1
Sequence:CCGGCCATGTGCATCACGCAGTTTACTCGAGTAAACTGCGTGATGCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013733.2-334s1c1
Sequence:CCGGCGTAGGCTTGAGTACAAAGTTCTCGAGAACTTTGTACTCAAGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013733.2-167s1c1
Sequence:CCGGCCAGTGAAGAGGTTAATACAACTCGAGTTGTATTAACCTCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013733.2-3114s1c1
Sequence:CCGGCCTGGACAGCTACTTCCAAATCTCGAGATTTGGAAGTAGCTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013733.2-1672s1c1
Sequence:CCGGCGGTGTGTCTGAAAGGAAGAACTCGAGTTCTTCCTTTCAGACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013733.2-2257s1c1
Sequence:CCGGGCTGCTACATGGCAATGTGAACTCGAGTTCACATTGCCATGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013733
VALIDATED
CHAF1A MISSION shRNA Lentiviral Transduction Particles
chromatin assembly factor 1, subunit A (p150)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013733.3-3113s21c1
Sequence:CCGGCCTGGACAGCTACTTCCAAATCTCGAGATTTGGAAGTAGCTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013733.3-333s21c1
Sequence:CCGGCGTAGGCTTGAGTACAAAGTTCTCGAGAACTTTGTACTCAAGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013733.3-1671s21c1
Sequence:CCGGCGGTGTGTCTGAAAGGAAGAACTCGAGTTCTTCCTTTCAGACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013733.3-405s21c1
Sequence:CCGGAGTACCGAGTGTGGTCATTATCTCGAGATAATGACCACACTCGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013733.3-2642s21c1
Sequence:CCGGCCATGTGCATCACGCAGTTTACTCGAGTAAACTGCGTGATGCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013733.2-334s1c1
Sequence:CCGGCGTAGGCTTGAGTACAAAGTTCTCGAGAACTTTGTACTCAAGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013733.2-167s1c1
Sequence:CCGGCCAGTGAAGAGGTTAATACAACTCGAGTTGTATTAACCTCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013733.2-3114s1c1
Sequence:CCGGCCTGGACAGCTACTTCCAAATCTCGAGATTTGGAAGTAGCTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013733.2-1672s1c1
Sequence:CCGGCGGTGTGTCTGAAAGGAAGAACTCGAGTTCTTCCTTTCAGACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013733.2-2257s1c1
Sequence:CCGGGCTGCTACATGGCAATGTGAACTCGAGTTCACATTGCCATGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005483
VALIDATED
CHAF1A MISSION shRNA Bacterial Glycerol Stock
chromatin assembly factor 1, subunit A (p150)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005483.2-3022s21c1
Sequence:CCGGGATACTTGAACCGACTCAATTCTCGAGAATTGAGTCGGTTCAAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005483.2-1396s21c1
Sequence:CCGGAGAAGAAGAGAAGCGCATTAACTCGAGTTAATGCGCTTCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005483.2-1062s21c1
Sequence:CCGGTAACTAAGAAATTCGTCAAAGCTCGAGCTTTGACGAATTTCTTAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005483.2-342s21c1
Sequence:CCGGTGGGTTCTGACATAGACTTTACTCGAGTAAAGTCTATGTCAGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005483.2-199s21c1
Sequence:CCGGACAAGCCCGTCTGCCGTTTAACTCGAGTTAAACGGCAGACGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_005483.2-3032s1c1
Sequence:CCGGCCGACTCAATTCCTGTGTAAACTCGAGTTTACACAGGAATTGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005483.2-350s1c1
Sequence:CCGGGACATAGACTTTAGACCGAAACTCGAGTTTCGGTCTAAAGTCTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005483.2-2332s1c1
Sequence:CCGGCGGCAATGTGAACGGGAGCAACTCGAGTTGCTCCCGTTCACATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005483.2-1051s1c1
Sequence:CCGGCCTCCGCAGAATAACTAAGAACTCGAGTTCTTAGTTATTCTGCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005483.2-1677s1c1
Sequence:CCGGCCACCCGGAATGCAGATATTTCTCGAGAAATATCTGCATTCCGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005483
VALIDATED
CHAF1A MISSION shRNA shRNA Plasmid DNA
chromatin assembly factor 1, subunit A (p150)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005483.2-3022s21c1
Sequence:CCGGGATACTTGAACCGACTCAATTCTCGAGAATTGAGTCGGTTCAAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005483.2-1396s21c1
Sequence:CCGGAGAAGAAGAGAAGCGCATTAACTCGAGTTAATGCGCTTCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005483.2-1062s21c1
Sequence:CCGGTAACTAAGAAATTCGTCAAAGCTCGAGCTTTGACGAATTTCTTAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005483.2-342s21c1
Sequence:CCGGTGGGTTCTGACATAGACTTTACTCGAGTAAAGTCTATGTCAGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005483.2-199s21c1
Sequence:CCGGACAAGCCCGTCTGCCGTTTAACTCGAGTTAAACGGCAGACGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_005483.2-3032s1c1
Sequence:CCGGCCGACTCAATTCCTGTGTAAACTCGAGTTTACACAGGAATTGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005483.2-350s1c1
Sequence:CCGGGACATAGACTTTAGACCGAAACTCGAGTTTCGGTCTAAAGTCTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005483.2-2332s1c1
Sequence:CCGGCGGCAATGTGAACGGGAGCAACTCGAGTTGCTCCCGTTCACATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005483.2-1051s1c1
Sequence:CCGGCCTCCGCAGAATAACTAAGAACTCGAGTTCTTAGTTATTCTGCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005483.2-1677s1c1
Sequence:CCGGCCACCCGGAATGCAGATATTTCTCGAGAAATATCTGCATTCCGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005483
VALIDATED
CHAF1A MISSION shRNA Lentiviral Transduction Particles
chromatin assembly factor 1, subunit A (p150)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005483.2-3022s21c1
Sequence:CCGGGATACTTGAACCGACTCAATTCTCGAGAATTGAGTCGGTTCAAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005483.2-1396s21c1
Sequence:CCGGAGAAGAAGAGAAGCGCATTAACTCGAGTTAATGCGCTTCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005483.2-1062s21c1
Sequence:CCGGTAACTAAGAAATTCGTCAAAGCTCGAGCTTTGACGAATTTCTTAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005483.2-342s21c1
Sequence:CCGGTGGGTTCTGACATAGACTTTACTCGAGTAAAGTCTATGTCAGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005483.2-199s21c1
Sequence:CCGGACAAGCCCGTCTGCCGTTTAACTCGAGTTAAACGGCAGACGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_005483.2-3032s1c1
Sequence:CCGGCCGACTCAATTCCTGTGTAAACTCGAGTTTACACAGGAATTGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005483.2-350s1c1
Sequence:CCGGGACATAGACTTTAGACCGAAACTCGAGTTTCGGTCTAAAGTCTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005483.2-2332s1c1
Sequence:CCGGCGGCAATGTGAACGGGAGCAACTCGAGTTGCTCCCGTTCACATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005483.2-1051s1c1
Sequence:CCGGCCTCCGCAGAATAACTAAGAACTCGAGTTCTTAGTTATTCTGCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005483.2-1677s1c1
Sequence:CCGGCCACCCGGAATGCAGATATTTCTCGAGAAATATCTGCATTCCGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks