EMAIL THIS PAGE TO A FRIEND

CHAF1B

chromatin assembly factor 1, subunit B (p60)

54 Gene Product Result for
Synonyms: CAF-1 CAF-IP60 CAF1 CAF1A CAF1P60 MPHOSPH7 MPP7
UniProtKB ID: Q13112, Q99548
Gene ID:
Human(8208) Summary: Chromatin assembly factor I (CAF-I) is required for the assembly of histone octamers onto newly-replicated DNA. CAF-I is composed of three protein subunits, p50, p60, and p150. The protein encoded by this gene corresponds to the p60 subunit and is required for chromatin assembly after replication. The encoded protein is differentially phosphorylated in a cell cycle-dependent manner. In addition, it is normally found in the nucleus except during mitosis, when it is released into the cytoplasm. This protein is a member of the WD-repeat HIR1 family and may also be involved in DNA repair. [provided by RefSeq, Jul 2008]
Mouse(110749) chromatin assembly factor 1, subunit B (p60)
Rat(288242) chromatin assembly factor 1, subunit B (p60)
sheep(101116195) chromatin assembly factor 1, subunit B (p60)
domestic guinea pig(100716517) chromatin assembly factor 1, subunit B (p60)
naked mole-rat(101725988) chromatin assembly factor 1, subunit B (p60)
Zebrafish(406285) chromatin assembly factor 1, subunit B
chicken(418514) chromatin assembly factor 1, subunit B (p60)
domestic cat(101082336) chromatin assembly factor 1, subunit B (p60)
cow(511654) chromatin assembly factor 1, subunit B (p60)
Horse(100061263) chromatin assembly factor 1, subunit B (p60)
dog(487750) chromatin assembly factor 1, subunit B (p60)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005441 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028083 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028083 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028083 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005441 Rosetta Predictions human pricing
NM_001024741 Rosetta Predictions rat pricing
NM_028083 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227819 predicted 1238
2 SASI_Hs02_00339596 predicted 398
3 SASI_Hs01_00227820 predicted 724
4 SASI_Hs01_00227821 predicted 599
5 SASI_Hs01_00227822 predicted 547
6 SASI_Hs01_00227823 predicted 399
7 SASI_Hs01_00227824 predicted 1630
8 SASI_Hs01_00227825 predicted 1241
9 SASI_Hs01_00227826 predicted 1149
10 SASI_Hs01_00227827 predicted 1311
11 SASI_Hs01_00227828 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024741 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092435 predicted 776
2 SASI_Rn01_00092436 predicted 575
3 SASI_Rn01_00092437 predicted 1143
4 SASI_Rn02_00202611 predicted 723
5 SASI_Rn01_00092438 predicted 730
6 SASI_Rn01_00092441 predicted 905
7 SASI_Rn01_00092442 predicted 1266
8 SASI_Rn01_00092443 predicted 556
9 SASI_Rn02_00202612 predicted 1143
10 SASI_Rn01_00092444 predicted 1146
11 SASI_Rn01_00092439 predicted 588
12 SASI_Rn01_00092440 predicted 1354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056747 predicted 763
2 SASI_Mm01_00056748 predicted 892
3 SASI_Mm01_00056749 predicted 1614
4 SASI_Mm01_00056750 predicted 877
5 SASI_Mm02_00333320 predicted 686
6 SASI_Mm01_00056751 predicted 819
7 SASI_Mm01_00056752 predicted 762
8 SASI_Mm01_00056753 predicted 1141
9 SASI_Mm01_00056754 predicted 1228
10 SASI_Mm01_00056755 predicted 557
11 SASI_Mm01_00056756 predicted 1139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005441
VALIDATED
CHAF1B MISSION shRNA Bacterial Glycerol Stock
chromatin assembly factor 1, subunit B (p60)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005441.2-1985s1c1
Sequence:CCGGGCTGTTGTATTCAGTATCCATCTCGAGATGGATACTGAATACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005441.2-802s1c1
Sequence:CCGGGCAAGAAGCTACCGGATGTTTCTCGAGAAACATCCGGTAGCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005441.2-405s1c1
Sequence:CCGGCATCCTATTGTGGAAGGTGAACTCGAGTTCACCTTCCACAATAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005441.2-723s1c1
Sequence:CCGGGCGAGTATACAGTATACAGAACTCGAGTTCTGTATACTGTATACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005441.2-328s1c1
Sequence:CCGGCGTCATACCAAAGCCGTCAATCTCGAGATTGACGGCTTTGGTATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005441
VALIDATED
CHAF1B MISSION shRNA shRNA Plasmid DNA
chromatin assembly factor 1, subunit B (p60)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005441.2-1985s1c1
Sequence:CCGGGCTGTTGTATTCAGTATCCATCTCGAGATGGATACTGAATACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005441.2-802s1c1
Sequence:CCGGGCAAGAAGCTACCGGATGTTTCTCGAGAAACATCCGGTAGCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005441.2-405s1c1
Sequence:CCGGCATCCTATTGTGGAAGGTGAACTCGAGTTCACCTTCCACAATAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005441.2-723s1c1
Sequence:CCGGGCGAGTATACAGTATACAGAACTCGAGTTCTGTATACTGTATACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005441.2-328s1c1
Sequence:CCGGCGTCATACCAAAGCCGTCAATCTCGAGATTGACGGCTTTGGTATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005441
VALIDATED
CHAF1B MISSION shRNA Lentiviral Transduction Particles
chromatin assembly factor 1, subunit B (p60)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005441.2-1985s1c1
Sequence:CCGGGCTGTTGTATTCAGTATCCATCTCGAGATGGATACTGAATACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005441.2-802s1c1
Sequence:CCGGGCAAGAAGCTACCGGATGTTTCTCGAGAAACATCCGGTAGCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005441.2-405s1c1
Sequence:CCGGCATCCTATTGTGGAAGGTGAACTCGAGTTCACCTTCCACAATAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005441.2-723s1c1
Sequence:CCGGGCGAGTATACAGTATACAGAACTCGAGTTCTGTATACTGTATACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005441.2-328s1c1
Sequence:CCGGCGTCATACCAAAGCCGTCAATCTCGAGATTGACGGCTTTGGTATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028083
VALIDATED
CHAF1B MISSION shRNA Bacterial Glycerol Stock
chromatin assembly factor 1, subunit B (p60)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028083.1-308s1c1
Sequence:CCGGGCTGTCAATGTTGTACGCTTTCTCGAGAAAGCGTACAACATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028083.1-796s1c1
Sequence:CCGGCGACAGCATGAAGTCGTTCTTCTCGAGAAGAACGACTTCATGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028083.1-718s1c1
Sequence:CCGGTGTGGCTTTCAACATTTCAAACTCGAGTTTGAAATGTTGAAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028083.1-691s1c1
Sequence:CCGGGCGGATCTATAATACCCAGAACTCGAGTTCTGGGTATTATAGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028083.1-370s1c1
Sequence:CCGGCGTCATTCTGTTGTGGAAGATCTCGAGATCTTCCACAACAGAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028083.4-717s21c1
Sequence:CCGGTGTGGCTTTCAACATTTCAAACTCGAGTTTGAAATGTTGAAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028083.4-307s21c1
Sequence:CCGGGCTGTCAATGTTGTACGCTTTCTCGAGAAAGCGTACAACATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028083.4-369s21c1
Sequence:CCGGCGTCATTCTGTTGTGGAAGATCTCGAGATCTTCCACAACAGAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028083.4-795s21c1
Sequence:CCGGCGACAGCATGAAGTCGTTCTTCTCGAGAAGAACGACTTCATGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028083
VALIDATED
CHAF1B MISSION shRNA shRNA Plasmid DNA
chromatin assembly factor 1, subunit B (p60)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028083.1-308s1c1
Sequence:CCGGGCTGTCAATGTTGTACGCTTTCTCGAGAAAGCGTACAACATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028083.1-796s1c1
Sequence:CCGGCGACAGCATGAAGTCGTTCTTCTCGAGAAGAACGACTTCATGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028083.1-718s1c1
Sequence:CCGGTGTGGCTTTCAACATTTCAAACTCGAGTTTGAAATGTTGAAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028083.1-691s1c1
Sequence:CCGGGCGGATCTATAATACCCAGAACTCGAGTTCTGGGTATTATAGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028083.1-370s1c1
Sequence:CCGGCGTCATTCTGTTGTGGAAGATCTCGAGATCTTCCACAACAGAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028083.4-717s21c1
Sequence:CCGGTGTGGCTTTCAACATTTCAAACTCGAGTTTGAAATGTTGAAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028083.4-307s21c1
Sequence:CCGGGCTGTCAATGTTGTACGCTTTCTCGAGAAAGCGTACAACATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028083.4-369s21c1
Sequence:CCGGCGTCATTCTGTTGTGGAAGATCTCGAGATCTTCCACAACAGAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028083.4-795s21c1
Sequence:CCGGCGACAGCATGAAGTCGTTCTTCTCGAGAAGAACGACTTCATGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028083
VALIDATED
CHAF1B MISSION shRNA Lentiviral Transduction Particles
chromatin assembly factor 1, subunit B (p60)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028083.1-308s1c1
Sequence:CCGGGCTGTCAATGTTGTACGCTTTCTCGAGAAAGCGTACAACATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028083.1-796s1c1
Sequence:CCGGCGACAGCATGAAGTCGTTCTTCTCGAGAAGAACGACTTCATGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028083.1-718s1c1
Sequence:CCGGTGTGGCTTTCAACATTTCAAACTCGAGTTTGAAATGTTGAAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028083.1-691s1c1
Sequence:CCGGGCGGATCTATAATACCCAGAACTCGAGTTCTGGGTATTATAGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028083.1-370s1c1
Sequence:CCGGCGTCATTCTGTTGTGGAAGATCTCGAGATCTTCCACAACAGAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028083.4-717s21c1
Sequence:CCGGTGTGGCTTTCAACATTTCAAACTCGAGTTTGAAATGTTGAAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028083.4-307s21c1
Sequence:CCGGGCTGTCAATGTTGTACGCTTTCTCGAGAAAGCGTACAACATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028083.4-369s21c1
Sequence:CCGGCGTCATTCTGTTGTGGAAGATCTCGAGATCTTCCACAACAGAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028083.4-795s21c1
Sequence:CCGGCGACAGCATGAAGTCGTTCTTCTCGAGAAGAACGACTTCATGCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks