EMAIL THIS PAGE TO A FRIEND

CHAT

choline O-acetyltransferase

121 Gene Product Result for
Synonyms: CHOACTASE CMS1A CMS1A2
UniProtKB ID: P28329, A2BDF4, Q16488, Q9BQ23, Q9BQ35, Q9BQE1
Gene ID:
Human(1103) Summary: This gene encodes an enzyme which catalyzes the biosynthesis of the neurotransmitter acetylcholine. This gene product is a characteristic feature of cholinergic neurons, and changes in these neurons may explain some of the symptoms of Alzheimer's disease. Polymorphisms in this gene have been associated with Alzheimer's disease and mild cognitive impairment. Mutations in this gene are associated with congenital myasthenic syndrome associated with episodic apnea. Multiple transcript variants encoding different isoforms have been found for this gene, and some of these variants have been shown to encode more than one isoform. [provided by RefSeq, May 2010]
Mouse(12647) choline acetyltransferase
Rat(290567) choline O-acetyltransferase
Zebrafish(100170938) choline acetyltransferase
cow(524732) choline O-acetyltransferase
domestic cat(751512) choline O-acetyltransferase
dog(486775) choline O-acetyltransferase
chicken(395314) choline O-acetyltransferase
Thale Cress(821249) acetyl CoA:(Z)-3-hexen-1-ol acetyltransferase
naked mole-rat(101711939) choline O-acetyltransferase
domestic guinea pig(100718930) choline O-acetyltransferase
sheep(101117817) choline O-acetyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Cofactor

Product # Description Species Add to Cart
 
A2181 Acetyl coenzyme A lithium salt ≥93% (HPLC) human, mouse, rat pricing
A2056 Acetyl coenzyme A sodium salt ≥93% (HPLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020549 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020549 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020549 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009891 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009891 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009891 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
AB2291 Anti-Choline acetylase Antibody 100 µg, Anti-Choline acetylase Antibody is an antibody against Choline acetylase for use in WB, IH. pricing
AB144 Anti-Choline Acetyltransferase Antibody 50 µL, Anti-Choline Acetyltransferase Antibody is an antibody against Choline Acetyltransferase for use in IH & WB. pricing
AB144P Anti-Choline Acetyltransferase Antibody 500 µL, Anti-Choline Acetyltransferase Antibody detects level of ChAT and has been published and validated for use in IH(P), IC, IH and WB. pricing
AB144P-1ML Anti-Choline Acetyltransferase Antibody 1 mL, Anti-Choline Acetyltransferase Antibody detects level of Choline Acetyltransferase & has been published & validated for use in IH & WB. pricing
AB144P-200UL Anti-Choline Acetyltransferase Antibody 200 µL, This Anti-Choline Acetyltransferase (ChAT) Antibody is validated for use in IC, IH, WB for the detection of Choline Acetyltransferase. pricing
AB15468 Anti-Choline Acetyltransferase Antibody 500 µL, Anti-Choline Acetyltransferase Antibody is an antibody against Choline Acetyltransferase for use in IC, IH. pricing
AB1582 Anti-Choline Acetyltransferase Antibody 100 µL, This Anti-Choline Acetyltransferase Antibody is validated for use in IH, WB for the detection of Choline Acetyltransferase. pricing
AB5042 Anti-Choline Acetyltransferase Antibody 100 µL, Detect Choline Acetyltransferase using this Anti-Choline Acetyltransferase Antibody validated for use in IH. pricing
AB5042P Anti-Choline Acetyltransferase Antibody 20 µg, Detect Choline Acetyltransferase using this Anti-Choline Acetyltransferase Antibody validated for use in ELISA, IH. pricing
MAB5422 Anti-Choline Acetyltransferase Antibody 100 µg, Anti-Choline Acetyltransferase Antibody detects level of Choline Acetyltransferase & has been published & validated for use in ELISA & WB. pricing
MAB5270-100UG Anti-Choline Acetyltransferase Antibody, clone 1.B3.9B3 100 µg, This Anti-Choline Acetyltransferase Antibody, clone 1.B3.9B3 is validated for use in ELISA, IH, IH(P), WB for the detection of Choline Acetyltransferase. pricing
MAB5270 Anti-Choline Acetyltransferase Antibody, clone 1.B3.9B3 100 µg, This Anti-Choline Acetyltransferase Antibody, clone 1.B3.9B3 is validated for use in ELISA, IH, IH(P), WB for the detection of Choline Acetyltransferase. pricing
MAB5270-50UG Anti-Choline Acetyltransferase Antibody, clone 1.B3.9B3 50 µg, Anti-Choline Acetyltransferase Antibody, clone 1.B3.9B3 is an antibody against Choline Acetyltransferase for use in ELISA, IH, IH(P) & WB. pricing
MAB305 Anti-Choline Acetyltransferase Antibody, clone 1E6 100 µL, Detect Choline Acetyltransferase using this Anti-Choline Acetyltransferase Antibody, clone 1E6 validated for use in IH. pricing
MAB5350 Anti-Choline Acetyltransferase Antibody, clone 28C4 100 µg, Anti-Choline Acetyltransferase Antibody, clone 28C4 detects level of Choline Acetyltransferase & has been published & validated for use in ELISA, IH & WB. pricing
AB143 Anti-Choline Acetyltransferase (ChAT) Antibody 50 µL, Anti-Choline Acetyltransferase (ChAT) Antibody is an antibody against Choline Acetyltransferase (ChAT) for use in IH, IH(P), IP & WB with more than 70 product citations. pricing
AG220 Choline Acetyltransferase, for Blocking AB143, AB144P Antibodies 10 µg pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020549 Rosetta Predictions human pricing
NM_020984 Rosetta Predictions human pricing
NM_020985 Rosetta Predictions human pricing
NM_020986 Rosetta Predictions human pricing
XM_001061520 Rosetta Predictions rat pricing
XM_224626 Rosetta Predictions rat pricing
NM_009891 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166959 predicted 1684
2 SASI_Hs01_00166960 predicted 1073
3 SASI_Hs02_00353592 predicted 1679
4 SASI_Hs01_00166961 predicted 1128
5 SASI_Hs01_00166962 predicted 1483
6 SASI_Hs01_00166963 predicted 859
7 SASI_Hs01_00166964 predicted 1848
8 SASI_Hs01_00166965 predicted 1985
9 SASI_Hs01_00166966 predicted 1086
10 SASI_Hs02_00353593 predicted 947
11 SASI_Hs01_00166958 predicted 774
12 SASI_Hs01_00166967 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027137 predicted 1353
2 SASI_Hs01_00027138 predicted 738
3 SASI_Hs02_00354433 predicted 1345
4 SASI_Hs01_00027139 predicted 792
5 SASI_Hs01_00027140 predicted 1148
6 SASI_Hs01_00027141 predicted 530
7 SASI_Hs01_00027142 predicted 1518
8 SASI_Hs01_00027143 predicted 1651
9 SASI_Hs01_00027144 predicted 755
10 SASI_Hs02_00354434 predicted 617
11 SASI_Hs01_00027136 predicted 418
12 SASI_Hs01_00027145 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234072 predicted 1515
2 SASI_Hs01_00234073 predicted 905
3 SASI_Hs02_00354435 predicted 1503
4 SASI_Hs01_00234074 predicted 957
5 SASI_Hs01_00234075 predicted 1307
6 SASI_Hs01_00234076 predicted 689
7 SASI_Hs01_00234077 predicted 1675
8 SASI_Hs01_00234078 predicted 1816
9 SASI_Hs01_00234079 predicted 915
10 SASI_Hs02_00354436 predicted 780
11 SASI_Hs01_00234071 predicted 575
12 SASI_Hs01_00234080 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049186 predicted 1341
2 SASI_Hs01_00049187 predicted 727
3 SASI_Hs02_00354437 predicted 1332
4 SASI_Hs01_00049188 predicted 785
5 SASI_Hs01_00049189 predicted 1131
6 SASI_Hs01_00049190 predicted 520
7 SASI_Hs01_00049191 predicted 1503
8 SASI_Hs01_00049192 predicted 1643
9 SASI_Hs01_00049193 predicted 744
10 SASI_Hs02_00354438 predicted 601
11 SASI_Hs01_00049185 predicted 396
12 SASI_Hs01_00049194 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061520 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300357 predicted 548
2 SASI_Rn02_00300358 predicted 1365
3 SASI_Rn02_00300359 predicted 341
4 SASI_Rn02_00300360 predicted 1974
5 SASI_Rn02_00300361 predicted 897
6 SASI_Rn02_00300362 predicted 852
7 SASI_Rn02_00300363 predicted 693
8 SASI_Rn02_00300364 predicted 663
9 SASI_Rn02_00300365 predicted 964
10 SASI_Rn02_00300366 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382117 predicted 2004
2 SASI_Rn02_00382118 predicted 2013
3 SASI_Rn02_00382119 predicted 339
4 SASI_Rn02_00382120 predicted 2013
5 SASI_Rn02_00382121 predicted 276
6 SASI_Rn02_00382122 predicted 368
7 SASI_Rn02_00382123 predicted 2002
8 SASI_Rn02_00382124 predicted 2046
9 SASI_Rn02_00382125 predicted 415
10 SASI_Rn02_00382126 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317390 predicted 2084
2 SASI_Mm01_00070643 predicted 712
3 SASI_Mm01_00070644 predicted 572
4 SASI_Mm02_00317391 predicted 1944
5 SASI_Mm01_00070646 predicted 1953
6 SASI_Mm01_00070648 predicted 1383
7 SASI_Mm01_00070649 predicted 984
8 SASI_Mm01_00070651 predicted 1543
9 SASI_Mm01_00070652 predicted 1630
10 SASI_Mm02_00317392 predicted 985
11 SASI_Mm01_00070645 predicted 589
12 SASI_Mm01_00070647 predicted 696
13 SASI_Mm01_00070650 predicted 1854
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020549
CHAT MISSION shRNA Bacterial Glycerol Stock
choline O-acetyltransferase
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020549.2-2095s1c1
Sequence:CCGGCCCGAGATGTTCATGGATGAACTCGAGTTCATCCATGAACATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020549.2-774s1c1
Sequence:CCGGGCTGAATGACATGTATCTCAACTCGAGTTGAGATACATGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020549.2-1704s1c1
Sequence:CCGGCCTTGACTTCATTGTCTATAACTCGAGTTATAGACAATGAAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020549.2-2308s1c1
Sequence:CCGGGCTGTGGAAGAAAGCCTCATTCTCGAGAATGAGGCTTTCTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020549.2-981s1c1
Sequence:CCGGCCTTTGCATGAAGCAATACTACTCGAGTAGTATTGCTTCATGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020549.4-1184s21c1
Sequence:CCGGACGAGCGTTTGCCTCCAATTGCTCGAGCAATTGGAGGCAAACGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020549
CHAT MISSION shRNA shRNA Plasmid DNA
choline O-acetyltransferase
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020549.2-2095s1c1
Sequence:CCGGCCCGAGATGTTCATGGATGAACTCGAGTTCATCCATGAACATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020549.2-774s1c1
Sequence:CCGGGCTGAATGACATGTATCTCAACTCGAGTTGAGATACATGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020549.2-1704s1c1
Sequence:CCGGCCTTGACTTCATTGTCTATAACTCGAGTTATAGACAATGAAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020549.2-2308s1c1
Sequence:CCGGGCTGTGGAAGAAAGCCTCATTCTCGAGAATGAGGCTTTCTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020549.2-981s1c1
Sequence:CCGGCCTTTGCATGAAGCAATACTACTCGAGTAGTATTGCTTCATGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020549.4-1184s21c1
Sequence:CCGGACGAGCGTTTGCCTCCAATTGCTCGAGCAATTGGAGGCAAACGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020549
CHAT MISSION shRNA Lentiviral Transduction Particles
choline O-acetyltransferase
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020549.2-2095s1c1
Sequence:CCGGCCCGAGATGTTCATGGATGAACTCGAGTTCATCCATGAACATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020549.2-774s1c1
Sequence:CCGGGCTGAATGACATGTATCTCAACTCGAGTTGAGATACATGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020549.2-1704s1c1
Sequence:CCGGCCTTGACTTCATTGTCTATAACTCGAGTTATAGACAATGAAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020549.2-2308s1c1
Sequence:CCGGGCTGTGGAAGAAAGCCTCATTCTCGAGAATGAGGCTTTCTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020549.2-981s1c1
Sequence:CCGGCCTTTGCATGAAGCAATACTACTCGAGTAGTATTGCTTCATGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020549.4-1184s21c1
Sequence:CCGGACGAGCGTTTGCCTCCAATTGCTCGAGCAATTGGAGGCAAACGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009891
CHAT MISSION shRNA Bacterial Glycerol Stock
choline O-acetyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009891.1-1503s1c1
Sequence:CCGGCGGCAGAGAAACTTCAAAGAACTCGAGTTCTTTGAAGTTTCTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009891.1-1925s1c1
Sequence:CCGGCCTGAGATGTTCATGGATGAACTCGAGTTCATCCATGAACATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009891.1-604s1c1
Sequence:CCGGGCTGAATGACATGTATCTAAACTCGAGTTTAGATACATGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009891.1-2566s1c1
Sequence:CCGGCGTCATCTCATCACATGCTATCTCGAGATAGCATGTGATGAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009891.1-1003s1c1
Sequence:CCGGTCAGTTGAGAAAGATAGTCAACTCGAGTTGACTATCTTTCTCAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009891
CHAT MISSION shRNA shRNA Plasmid DNA
choline O-acetyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009891.1-1503s1c1
Sequence:CCGGCGGCAGAGAAACTTCAAAGAACTCGAGTTCTTTGAAGTTTCTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009891.1-1925s1c1
Sequence:CCGGCCTGAGATGTTCATGGATGAACTCGAGTTCATCCATGAACATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009891.1-604s1c1
Sequence:CCGGGCTGAATGACATGTATCTAAACTCGAGTTTAGATACATGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009891.1-2566s1c1
Sequence:CCGGCGTCATCTCATCACATGCTATCTCGAGATAGCATGTGATGAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009891.1-1003s1c1
Sequence:CCGGTCAGTTGAGAAAGATAGTCAACTCGAGTTGACTATCTTTCTCAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009891
CHAT MISSION shRNA Lentiviral Transduction Particles
choline O-acetyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009891.1-1503s1c1
Sequence:CCGGCGGCAGAGAAACTTCAAAGAACTCGAGTTCTTTGAAGTTTCTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009891.1-1925s1c1
Sequence:CCGGCCTGAGATGTTCATGGATGAACTCGAGTTCATCCATGAACATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009891.1-604s1c1
Sequence:CCGGGCTGAATGACATGTATCTAAACTCGAGTTTAGATACATGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009891.1-2566s1c1
Sequence:CCGGCGTCATCTCATCACATGCTATCTCGAGATAGCATGTGATGAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009891.1-1003s1c1
Sequence:CCGGTCAGTTGAGAAAGATAGTCAACTCGAGTTGACTATCTTTCTCAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks