EMAIL THIS PAGE TO A FRIEND

CHCHD10

coiled-coil-helix-coiled-coil-helix domain containing 10

77 Gene Product Result for
Synonyms: C22orf16 N27C7-4
UniProtKB ID: Q8WYQ3, A8K0J5
Gene ID:
Mouse(103172) coiled-coil-helix-coiled-coil-helix domain containing 10
Rat(361824) coiled-coil-helix-coiled-coil-helix domain containing 10
naked mole-rat(101700511) coiled-coil-helix-coiled-coil-helix domain containing 10
domestic guinea pig(100735227) coiled-coil-helix-coiled-coil-helix domain containing 10
sheep(101110091) coiled-coil-helix-coiled-coil-helix domain containing 10
Zebrafish(393757) coiled-coil-helix-coiled-coil-helix domain containing 10
cow(615846) coiled-coil-helix-coiled-coil-helix domain containing 10
domestic cat(101088883) coiled-coil-helix-coiled-coil-helix domain containing 10
dog(477560) coiled-coil-helix-coiled-coil-helix domain containing 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175329 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175329 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175329 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_213720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_213720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_213720 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142551 MISSION® esiRNA esiRNA human CHCHD10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_213720 Rosetta Predictions human pricing
NM_001007008 Rosetta Predictions rat pricing
XM_001079820 Rosetta Predictions rat pricing
NM_175329 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245602 predicted 627
2 SASI_Hs02_00374358 predicted 400
3 SASI_Hs01_00245603 predicted 637
4 SASI_Hs02_00374359 predicted 396
5 SASI_Hs01_00245604 predicted 378
6 SASI_Hs01_00245605 predicted 401
7 SASI_Hs01_00245606 predicted 403
8 SASI_Hs01_00245607 predicted 568
9 SASI_Hs01_00245608 predicted 634
10 SASI_Hs01_00245609 predicted 639
11 SASI_Hs01_00245610 predicted 473
12 SASI_Hs01_00245611 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198595 predicted 342
2 SASI_Rn02_00198596 predicted 346
3 SASI_Rn01_00062173 predicted 341
4 SASI_Rn01_00062174 predicted 204
5 SASI_Rn01_00062175 predicted 349
6 SASI_Rn01_00062176 predicted 344
7 SASI_Rn01_00062177 predicted 358
8 SASI_Rn01_00062179 predicted 391
9 SASI_Rn01_00062180 predicted 380
10 SASI_Rn01_00062181 predicted 201
11 SASI_Rn01_00062178 predicted 213
12 SASI_Rn01_00062182 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365608 predicted 309
2 SASI_Rn02_00365609 predicted 313
3 SASI_Rn02_00365610 predicted 316
4 SASI_Rn02_00365611 predicted 325
5 SASI_Rn02_00365612 predicted 313
6 SASI_Rn02_00365613 predicted 332
7 SASI_Rn02_00365614 predicted 359
8 SASI_Rn02_00365615 predicted 356
9 SASI_Rn02_00365616 predicted 369
10 SASI_Rn02_00365617 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175329 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173216 predicted 677
2 SASI_Mm01_00173217 predicted 692
3 SASI_Mm02_00346110 predicted 499
4 SASI_Mm01_00173218 predicted 494
5 SASI_Mm02_00346111 predicted 488
6 SASI_Mm01_00173219 predicted 528
7 SASI_Mm01_00173220 predicted 724
8 SASI_Mm01_00173221 predicted 703
9 SASI_Mm01_00173223 predicted 532
10 SASI_Mm01_00173224 predicted 551
11 SASI_Mm01_00173222 predicted 498
12 SASI_Mm01_00173225 predicted 554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175329
CHCHD10 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 10
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000193066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175329.3-763s1c1
Sequence:CCGGCCTCAAACAGTGCAAATACAACTCGAGTTGTATTTGCACTGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175329.3-764s1c1
Sequence:CCGGCTCAAACAGTGCAAATACAATCTCGAGATTGTATTTGCACTGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175329.3-770s1c1
Sequence:CCGGCAGTGCAAATACAATCACGGTCTCGAGACCGTGATTGTATTTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175329.3-762s1c1
Sequence:CCGGCCCTCAAACAGTGCAAATACACTCGAGTGTATTTGCACTGTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175329
CHCHD10 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 10
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000193066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175329.3-763s1c1
Sequence:CCGGCCTCAAACAGTGCAAATACAACTCGAGTTGTATTTGCACTGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175329.3-764s1c1
Sequence:CCGGCTCAAACAGTGCAAATACAATCTCGAGATTGTATTTGCACTGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175329.3-770s1c1
Sequence:CCGGCAGTGCAAATACAATCACGGTCTCGAGACCGTGATTGTATTTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175329.3-762s1c1
Sequence:CCGGCCCTCAAACAGTGCAAATACACTCGAGTGTATTTGCACTGTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175329
CHCHD10 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 10
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000193066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175329.3-763s1c1
Sequence:CCGGCCTCAAACAGTGCAAATACAACTCGAGTTGTATTTGCACTGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175329.3-764s1c1
Sequence:CCGGCTCAAACAGTGCAAATACAATCTCGAGATTGTATTTGCACTGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175329.3-770s1c1
Sequence:CCGGCAGTGCAAATACAATCACGGTCTCGAGACCGTGATTGTATTTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175329.3-762s1c1
Sequence:CCGGCCCTCAAACAGTGCAAATACACTCGAGTGTATTTGCACTGTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213720
VALIDATED
CHCHD10 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 10
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181218    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_213720.1-581s1c1
Sequence:CCGGCCAGATTGTACCCAGATAGCTCTCGAGAGCTATCTGGGTACAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_213720.1-436s21c1
Sequence:CCGGTGTCCCTGTGTGAGGGCTTCACTCGAGTGAAGCCCTCACACAGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_213720.1-464s21c1
Sequence:CCGGCCTGAAGCAGTGCAAGTACTACTCGAGTAGTACTTGCACTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_213720.1-211s21c1
Sequence:CCGGTCATGGCTCAGATGGCGACCACTCGAGTGGTCGCCATCTGAGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_213720.1-409s21c1
Sequence:CCGGTGGACTGTTCCACCACTCAGACTCGAGTCTGAGTGGTGGAACAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_213720.1-568s21c1
Sequence:CCGGCCAGACCACAACACCAGATTGCTCGAGCAATCTGGTGTTGTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213720
VALIDATED
CHCHD10 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 10
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181218    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_213720.1-581s1c1
Sequence:CCGGCCAGATTGTACCCAGATAGCTCTCGAGAGCTATCTGGGTACAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_213720.1-436s21c1
Sequence:CCGGTGTCCCTGTGTGAGGGCTTCACTCGAGTGAAGCCCTCACACAGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_213720.1-464s21c1
Sequence:CCGGCCTGAAGCAGTGCAAGTACTACTCGAGTAGTACTTGCACTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_213720.1-211s21c1
Sequence:CCGGTCATGGCTCAGATGGCGACCACTCGAGTGGTCGCCATCTGAGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_213720.1-409s21c1
Sequence:CCGGTGGACTGTTCCACCACTCAGACTCGAGTCTGAGTGGTGGAACAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_213720.1-568s21c1
Sequence:CCGGCCAGACCACAACACCAGATTGCTCGAGCAATCTGGTGTTGTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213720
VALIDATED
CHCHD10 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 10
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181218    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_213720.1-581s1c1
Sequence:CCGGCCAGATTGTACCCAGATAGCTCTCGAGAGCTATCTGGGTACAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_213720.1-436s21c1
Sequence:CCGGTGTCCCTGTGTGAGGGCTTCACTCGAGTGAAGCCCTCACACAGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_213720.1-464s21c1
Sequence:CCGGCCTGAAGCAGTGCAAGTACTACTCGAGTAGTACTTGCACTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_213720.1-211s21c1
Sequence:CCGGTCATGGCTCAGATGGCGACCACTCGAGTGGTCGCCATCTGAGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_213720.1-409s21c1
Sequence:CCGGTGGACTGTTCCACCACTCAGACTCGAGTCTGAGTGGTGGAACAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_213720.1-568s21c1
Sequence:CCGGCCAGACCACAACACCAGATTGCTCGAGCAATCTGGTGTTGTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks