EMAIL THIS PAGE TO A FRIEND

CHCHD1

coiled-coil-helix-coiled-coil-helix domain containing 1

77 Gene Product Result for
Synonyms: C10orf34 C2360
UniProtKB ID: Q96BP2
Gene ID:
Mouse(66121) coiled-coil-helix-coiled-coil-helix domain containing 1
Rat(361005) coiled-coil-helix-coiled-coil-helix domain containing 1
Zebrafish(557606) coiled-coil-helix-coiled-coil-helix domain containing 1
dog(609960) coiled-coil-helix-coiled-coil-helix domain containing 1
domestic cat(101088694) coiled-coil-helix-coiled-coil-helix domain containing 1
cow(540610) coiled-coil-helix-coiled-coil-helix domain containing 1
chicken(423741) coiled-coil-helix-coiled-coil-helix domain containing 1
Goat(100861355) coiled-coil-helix-coiled-coil-helix domain containing 1
sheep(101120800) coiled-coil-helix-coiled-coil-helix domain containing 1
domestic guinea pig(100721263) coiled-coil-helix-coiled-coil-helix domain containing 1
naked mole-rat(101711769) coiled-coil-helix-coiled-coil-helix domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203298 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025366 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025366 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025366 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203298 Rosetta Predictions human pricing
NM_001108369 Rosetta Predictions rat pricing
NM_025366 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373223 predicted 618
2 SASI_Hs01_00100924 predicted 307
3 SASI_Hs01_00100925 predicted 272
4 SASI_Hs02_00373224 predicted 499
5 SASI_Hs01_00100926 predicted 267
6 SASI_Hs02_00373225 predicted 525
7 SASI_Hs02_00373226 predicted 350
8 SASI_Hs02_00373227 predicted 407
9 SASI_Hs01_00100927 predicted 345
10 SASI_Hs02_00373228 predicted 500
11 SASI_Hs01_00100922 predicted 296
12 SASI_Hs01_00100923 predicted 252
13 SASI_Hs01_00100928 predicted 257
14 SASI_Hs01_00100929 predicted 283
15 SASI_Hs01_00100930 predicted 304
16 SASI_Hs01_00100931 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237989 predicted 225
2 SASI_Rn02_00237990 predicted 293
3 SASI_Rn02_00237991 predicted 325
4 SASI_Rn02_00237992 predicted 226
5 SASI_Rn02_00237993 predicted 297
6 SASI_Rn02_00237994 predicted 330
7 SASI_Rn02_00237995 predicted 226
8 SASI_Rn02_00237996 predicted 287
9 SASI_Rn02_00237997 predicted 334
10 SASI_Rn02_00237998 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025366 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094472 predicted 209
2 SASI_Mm01_00094473 predicted 212
3 SASI_Mm01_00094474 predicted 283
4 SASI_Mm01_00094475 predicted 313
5 SASI_Mm01_00094476 predicted 272
6 SASI_Mm01_00094478 predicted 258
7 SASI_Mm01_00094479 predicted 207
8 SASI_Mm01_00094480 predicted 312
9 SASI_Mm02_00328079 predicted 194
10 SASI_Mm02_00328080 predicted 214
11 SASI_Mm01_00094477 predicted 317
12 SASI_Mm01_00094481 predicted 216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203298
VALIDATED
CHCHD1 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-163s21c1
Sequence:CCGGTCACGGAGATGTCGGTGATGACTCGAGTCATCACCGACATCTCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-154s21c1
Sequence:CCGGCGACTTGCATCACGGAGATGTCTCGAGACATCTCCGTGATGCAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-83s21c1
Sequence:CCGGTGTGCTGAAGCCCAATAAACCCTCGAGGGTTTATTGGGCTTCAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-357s21c1
Sequence:CCGGTTTCCTAACAAACCTTACCTCCTCGAGGAGGTAAGGTTTGTTAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-286s21c1
Sequence:CCGGGATCAATACAGGAAACCCTGGCTCGAGCCAGGGTTTCCTGTATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-263s21c1
Sequence:CCGGGGCTCAGGAAGCCCGAAAGATCTCGAGATCTTTCGGGCTTCCTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203298.1-401s1c1
Sequence:CCGGCTGACAACTATGCAGAGGCATCTCGAGATGCCTCTGCATAGTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_203298.1-291s1c1
Sequence:CCGGGTCTGGGAGTTTACTTCCAAACTCGAGTTTGGAAGTAAACTCCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203298.1-264s1c1
Sequence:CCGGGAGATCAATACAGGAAACCCTCTCGAGAGGGTTTCCTGTATTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_203298.1-318s1c1
Sequence:CCGGGAATAAGTTGTTACAGAGGTTCTCGAGAACCTCTGTAACAACTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203298.1-324s1c1
Sequence:CCGGGTTGTTACAGAGGTTTCCTAACTCGAGTTAGGAAACCTCTGTAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_203298.1-255s1c1
Sequence:CCGGCCGAAAGATGAGATCAATACACTCGAGTGTATTGATCTCATCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_203298.1-72s1c1
Sequence:CCGGGCCCAATAAACCTCTCATTCTCTCGAGAGAATGAGAGGTTTATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203298
VALIDATED
CHCHD1 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-163s21c1
Sequence:CCGGTCACGGAGATGTCGGTGATGACTCGAGTCATCACCGACATCTCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-154s21c1
Sequence:CCGGCGACTTGCATCACGGAGATGTCTCGAGACATCTCCGTGATGCAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-83s21c1
Sequence:CCGGTGTGCTGAAGCCCAATAAACCCTCGAGGGTTTATTGGGCTTCAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-357s21c1
Sequence:CCGGTTTCCTAACAAACCTTACCTCCTCGAGGAGGTAAGGTTTGTTAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-286s21c1
Sequence:CCGGGATCAATACAGGAAACCCTGGCTCGAGCCAGGGTTTCCTGTATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-263s21c1
Sequence:CCGGGGCTCAGGAAGCCCGAAAGATCTCGAGATCTTTCGGGCTTCCTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203298.1-401s1c1
Sequence:CCGGCTGACAACTATGCAGAGGCATCTCGAGATGCCTCTGCATAGTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_203298.1-291s1c1
Sequence:CCGGGTCTGGGAGTTTACTTCCAAACTCGAGTTTGGAAGTAAACTCCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203298.1-264s1c1
Sequence:CCGGGAGATCAATACAGGAAACCCTCTCGAGAGGGTTTCCTGTATTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_203298.1-318s1c1
Sequence:CCGGGAATAAGTTGTTACAGAGGTTCTCGAGAACCTCTGTAACAACTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203298.1-324s1c1
Sequence:CCGGGTTGTTACAGAGGTTTCCTAACTCGAGTTAGGAAACCTCTGTAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_203298.1-255s1c1
Sequence:CCGGCCGAAAGATGAGATCAATACACTCGAGTGTATTGATCTCATCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_203298.1-72s1c1
Sequence:CCGGGCCCAATAAACCTCTCATTCTCTCGAGAGAATGAGAGGTTTATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203298
VALIDATED
CHCHD1 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-163s21c1
Sequence:CCGGTCACGGAGATGTCGGTGATGACTCGAGTCATCACCGACATCTCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-154s21c1
Sequence:CCGGCGACTTGCATCACGGAGATGTCTCGAGACATCTCCGTGATGCAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-83s21c1
Sequence:CCGGTGTGCTGAAGCCCAATAAACCCTCGAGGGTTTATTGGGCTTCAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-357s21c1
Sequence:CCGGTTTCCTAACAAACCTTACCTCCTCGAGGAGGTAAGGTTTGTTAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-286s21c1
Sequence:CCGGGATCAATACAGGAAACCCTGGCTCGAGCCAGGGTTTCCTGTATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203298.2-263s21c1
Sequence:CCGGGGCTCAGGAAGCCCGAAAGATCTCGAGATCTTTCGGGCTTCCTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203298.1-401s1c1
Sequence:CCGGCTGACAACTATGCAGAGGCATCTCGAGATGCCTCTGCATAGTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_203298.1-291s1c1
Sequence:CCGGGTCTGGGAGTTTACTTCCAAACTCGAGTTTGGAAGTAAACTCCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203298.1-264s1c1
Sequence:CCGGGAGATCAATACAGGAAACCCTCTCGAGAGGGTTTCCTGTATTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_203298.1-318s1c1
Sequence:CCGGGAATAAGTTGTTACAGAGGTTCTCGAGAACCTCTGTAACAACTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203298.1-324s1c1
Sequence:CCGGGTTGTTACAGAGGTTTCCTAACTCGAGTTAGGAAACCTCTGTAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_203298.1-255s1c1
Sequence:CCGGCCGAAAGATGAGATCAATACACTCGAGTGTATTGATCTCATCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_203298.1-72s1c1
Sequence:CCGGGCCCAATAAACCTCTCATTCTCTCGAGAGAATGAGAGGTTTATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025366
VALIDATED
CHCHD1 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025366.2-344s1c1
Sequence:CCGGCAAATCTCATCTCATCTGAAACTCGAGTTTCAGATGAGATGAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025366.2-308s21c1
Sequence:CCGGCCACAAGATGACCAAGTTGTTCTCGAGAACAACTTGGTCATCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025366.2-317s21c1
Sequence:CCGGGACCAAGTTGTTACAGAGATTCTCGAGAATCTCTGTAACAACTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025366.2-380s21c1
Sequence:CCGGCAATGAACTCTCATTTCCAAACTCGAGTTTGGAAATGAGAGTTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025366.2-77s21c1
Sequence:CCGGCAAGCCTCTTATCTTAGCTAACTCGAGTTAGCTAAGATAAGAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025366.1-381s1c1
Sequence:CCGGCAATGAACTCTCATTTCCAAACTCGAGTTTGGAAATGAGAGTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025366.1-69s1c1
Sequence:CCGGGAAACCCAACAAGCCTCTTATCTCGAGATAAGAGGCTTGTTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025366.1-78s1c1
Sequence:CCGGCAAGCCTCTTATCTTAGCTAACTCGAGTTAGCTAAGATAAGAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025366.1-318s1c1
Sequence:CCGGGACCAAGTTGTTACAGAGATTCTCGAGAATCTCTGTAACAACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025366.1-309s1c1
Sequence:CCGGCCACAAGATGACCAAGTTGTTCTCGAGAACAACTTGGTCATCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025366
VALIDATED
CHCHD1 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025366.2-344s1c1
Sequence:CCGGCAAATCTCATCTCATCTGAAACTCGAGTTTCAGATGAGATGAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025366.2-308s21c1
Sequence:CCGGCCACAAGATGACCAAGTTGTTCTCGAGAACAACTTGGTCATCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025366.2-317s21c1
Sequence:CCGGGACCAAGTTGTTACAGAGATTCTCGAGAATCTCTGTAACAACTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025366.2-380s21c1
Sequence:CCGGCAATGAACTCTCATTTCCAAACTCGAGTTTGGAAATGAGAGTTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025366.2-77s21c1
Sequence:CCGGCAAGCCTCTTATCTTAGCTAACTCGAGTTAGCTAAGATAAGAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025366.1-381s1c1
Sequence:CCGGCAATGAACTCTCATTTCCAAACTCGAGTTTGGAAATGAGAGTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025366.1-69s1c1
Sequence:CCGGGAAACCCAACAAGCCTCTTATCTCGAGATAAGAGGCTTGTTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025366.1-78s1c1
Sequence:CCGGCAAGCCTCTTATCTTAGCTAACTCGAGTTAGCTAAGATAAGAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025366.1-318s1c1
Sequence:CCGGGACCAAGTTGTTACAGAGATTCTCGAGAATCTCTGTAACAACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025366.1-309s1c1
Sequence:CCGGCCACAAGATGACCAAGTTGTTCTCGAGAACAACTTGGTCATCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025366
VALIDATED
CHCHD1 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025366.2-344s1c1
Sequence:CCGGCAAATCTCATCTCATCTGAAACTCGAGTTTCAGATGAGATGAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025366.2-308s21c1
Sequence:CCGGCCACAAGATGACCAAGTTGTTCTCGAGAACAACTTGGTCATCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025366.2-317s21c1
Sequence:CCGGGACCAAGTTGTTACAGAGATTCTCGAGAATCTCTGTAACAACTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025366.2-380s21c1
Sequence:CCGGCAATGAACTCTCATTTCCAAACTCGAGTTTGGAAATGAGAGTTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025366.2-77s21c1
Sequence:CCGGCAAGCCTCTTATCTTAGCTAACTCGAGTTAGCTAAGATAAGAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025366.1-381s1c1
Sequence:CCGGCAATGAACTCTCATTTCCAAACTCGAGTTTGGAAATGAGAGTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025366.1-69s1c1
Sequence:CCGGGAAACCCAACAAGCCTCTTATCTCGAGATAAGAGGCTTGTTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025366.1-78s1c1
Sequence:CCGGCAAGCCTCTTATCTTAGCTAACTCGAGTTAGCTAAGATAAGAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025366.1-318s1c1
Sequence:CCGGGACCAAGTTGTTACAGAGATTCTCGAGAATCTCTGTAACAACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025366.1-309s1c1
Sequence:CCGGCCACAAGATGACCAAGTTGTTCTCGAGAACAACTTGGTCATCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks