EMAIL THIS PAGE TO A FRIEND

CHCHD2

coiled-coil-helix-coiled-coil-helix domain containing 2

55 Gene Product Result for
Synonyms: C7orf17
UniProtKB ID: Q9Y6H1, Q498C3, Q6NZ50
Gene ID:
Mouse(14004) coiled-coil-helix-coiled-coil-helix domain containing 2
Rat(316643) coiled-coil-helix-coiled-coil-helix domain containing 2
Zebrafish(393740) coiled-coil-helix-coiled-coil-helix domain containing 2
cow(614033) coiled-coil-helix-coiled-coil-helix domain containing 2
domestic cat(101080932) coiled-coil-helix-coiled-coil-helix domain containing 2
dog(479702) coiled-coil-helix-coiled-coil-helix domain containing 2
chicken(417544) coiled-coil-helix-coiled-coil-helix domain containing 2
sheep(101108017) coiled-coil-helix-coiled-coil-helix domain containing 2
domestic guinea pig(100732922) coiled-coil-helix-coiled-coil-helix domain containing 2
naked mole-rat(101707417) coiled-coil-helix-coiled-coil-helix domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016139 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024166 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024166 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024166 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016139 Rosetta Predictions human pricing
NM_001015019 Rosetta Predictions rat pricing
XM_001052992 Rosetta Predictions rat pricing
NM_024166 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182688 predicted 299
2 SASI_Hs01_00182689 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093076 predicted 302
2 SASI_Rn02_00202053 predicted 423
3 SASI_Rn01_00093072 predicted 423
4 SASI_Rn01_00093073 predicted 418
5 SASI_Rn01_00093074 predicted 410
6 SASI_Rn02_00202054 predicted 301
7 SASI_Rn02_00202055 predicted 303
8 SASI_Rn02_00202056 predicted 215
9 SASI_Rn02_00202057 predicted 370
10 SASI_Rn02_00202058 predicted 244
11 SASI_Rn01_00093075 predicted 431
12 SASI_Rn01_00093077 predicted 34
13 SASI_Rn01_00093078 predicted 542
14 SASI_Rn01_00093079 predicted 560
15 SASI_Rn01_00093080 predicted 520
16 SASI_Rn01_00093081 predicted 189
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270974 predicted 543
2 SASI_Rn02_00270975 predicted 547
3 SASI_Rn02_00270976 predicted 512
4 SASI_Rn02_00270977 predicted 562
5 SASI_Rn02_00270978 predicted 475
6 SASI_Rn02_00270979 predicted 468
7 SASI_Rn02_00270980 predicted 547
8 SASI_Rn02_00270981 predicted 623
9 SASI_Rn02_00270982 predicted 603
10 SASI_Rn02_00270983 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327468 predicted 777
2 SASI_Mm02_00327469 predicted 771
3 SASI_Mm02_00327470 predicted 818
4 SASI_Mm01_00169147 predicted 227
5 SASI_Mm01_00169148 predicted 660
6 SASI_Mm01_00169149 predicted 657
7 SASI_Mm01_00169150 predicted 664
8 SASI_Mm01_00169151 predicted 663
9 SASI_Mm01_00169152 predicted 660
10 SASI_Mm01_00169153 predicted 390
11 SASI_Mm01_00169154 predicted 752
12 SASI_Mm01_00169155 predicted 707
13 SASI_Mm01_00169156 predicted 763
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016139
VALIDATED
CHCHD2 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016139.2-463s21c1
Sequence:CCGGCAGGGTGACATCAAGCTCTGTCTCGAGACAGAGCTTGATGTCACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016139.2-504s21c1
Sequence:CCGGGAAACAGTGCCGACTTGCAAACTCGAGTTTGCAAGTCGGCACTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_016139.2-333s21c1
Sequence:CCGGCAGTGGAGGAAGTAATGCTGACTCGAGTCAGCATTACTTCCTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016139.2-637s21c1
Sequence:CCGGCAGTTAAACCTCTCCTGTCATCTCGAGATGACAGGAGAGGTTTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016139.2-423s1c1
Sequence:CCGGCCTCTATGAGATCAAACAGTTCTCGAGAACTGTTTGATCTCATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016139.2-463s1c1
Sequence:CCGGCAGGGTGACATCAAGCTCTGTCTCGAGACAGAGCTTGATGTCACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016139.2-637s1c1
Sequence:CCGGCAGTTAAACCTCTCCTGTCATCTCGAGATGACAGGAGAGGTTTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016139.2-504s1c1
Sequence:CCGGGAAACAGTGCCGACTTGCAAACTCGAGTTTGCAAGTCGGCACTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016139.2-333s1c1
Sequence:CCGGCAGTGGAGGAAGTAATGCTGACTCGAGTCAGCATTACTTCCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016139.2-329s1c1
Sequence:CCGGGCTTCAGTGGAGGAAGTAATGCTCGAGCATTACTTCCTCCACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016139
VALIDATED
CHCHD2 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016139.2-463s21c1
Sequence:CCGGCAGGGTGACATCAAGCTCTGTCTCGAGACAGAGCTTGATGTCACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016139.2-504s21c1
Sequence:CCGGGAAACAGTGCCGACTTGCAAACTCGAGTTTGCAAGTCGGCACTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_016139.2-333s21c1
Sequence:CCGGCAGTGGAGGAAGTAATGCTGACTCGAGTCAGCATTACTTCCTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016139.2-637s21c1
Sequence:CCGGCAGTTAAACCTCTCCTGTCATCTCGAGATGACAGGAGAGGTTTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016139.2-423s1c1
Sequence:CCGGCCTCTATGAGATCAAACAGTTCTCGAGAACTGTTTGATCTCATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016139.2-463s1c1
Sequence:CCGGCAGGGTGACATCAAGCTCTGTCTCGAGACAGAGCTTGATGTCACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016139.2-637s1c1
Sequence:CCGGCAGTTAAACCTCTCCTGTCATCTCGAGATGACAGGAGAGGTTTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016139.2-504s1c1
Sequence:CCGGGAAACAGTGCCGACTTGCAAACTCGAGTTTGCAAGTCGGCACTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016139.2-333s1c1
Sequence:CCGGCAGTGGAGGAAGTAATGCTGACTCGAGTCAGCATTACTTCCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016139.2-329s1c1
Sequence:CCGGGCTTCAGTGGAGGAAGTAATGCTCGAGCATTACTTCCTCCACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016139
VALIDATED
CHCHD2 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016139.2-463s21c1
Sequence:CCGGCAGGGTGACATCAAGCTCTGTCTCGAGACAGAGCTTGATGTCACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016139.2-504s21c1
Sequence:CCGGGAAACAGTGCCGACTTGCAAACTCGAGTTTGCAAGTCGGCACTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_016139.2-333s21c1
Sequence:CCGGCAGTGGAGGAAGTAATGCTGACTCGAGTCAGCATTACTTCCTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016139.2-637s21c1
Sequence:CCGGCAGTTAAACCTCTCCTGTCATCTCGAGATGACAGGAGAGGTTTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016139.2-423s1c1
Sequence:CCGGCCTCTATGAGATCAAACAGTTCTCGAGAACTGTTTGATCTCATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016139.2-463s1c1
Sequence:CCGGCAGGGTGACATCAAGCTCTGTCTCGAGACAGAGCTTGATGTCACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016139.2-637s1c1
Sequence:CCGGCAGTTAAACCTCTCCTGTCATCTCGAGATGACAGGAGAGGTTTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016139.2-504s1c1
Sequence:CCGGGAAACAGTGCCGACTTGCAAACTCGAGTTTGCAAGTCGGCACTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016139.2-333s1c1
Sequence:CCGGCAGTGGAGGAAGTAATGCTGACTCGAGTCAGCATTACTTCCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016139.2-329s1c1
Sequence:CCGGGCTTCAGTGGAGGAAGTAATGCTCGAGCATTACTTCCTCCACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024166
VALIDATED
CHCHD2 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024166.6-604s21c1
Sequence:CCGGTCAGAACCAGAGCGATGTCAACTCGAGTTGACATCGCTCTGGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024166.6-500s21c1
Sequence:CCGGGCAAAGCCCGACATCACTTACCTCGAGGTAAGTGATGTCGGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024166.6-573s21c1
Sequence:CCGGCTCTAGAGATCAAGCAGTTTCCTCGAGGAAACTGCTTGATCTCTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024166.6-661s21c1
Sequence:CCGGCAGGATTGCAAATGGTTTAATCTCGAGATTAAACCATTTGCAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024166.6-661s1c1
Sequence:CCGGCAGGATTGCAAATGGTTTAATCTCGAGATTAAACCATTTGCAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024166.6-738s21c1
Sequence:CCGGACAAGTGTGGACCCTTATATTCTCGAGAATATAAGGGTCCACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183263    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024166.4-708s1c1
Sequence:CCGGGATGTAACATTGGTTCTGTATCTCGAGATACAGAACCAATGTTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180376    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024166.4-737s1c1
Sequence:CCGGGTACAAGTGTGGACCCTTATACTCGAGTATAAGGGTCCACACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024166.4-565s1c1
Sequence:CCGGGACCTTGCTCTCTAGAGATCACTCGAGTGATCTCTAGAGAGCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024166
VALIDATED
CHCHD2 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024166.6-604s21c1
Sequence:CCGGTCAGAACCAGAGCGATGTCAACTCGAGTTGACATCGCTCTGGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024166.6-500s21c1
Sequence:CCGGGCAAAGCCCGACATCACTTACCTCGAGGTAAGTGATGTCGGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024166.6-573s21c1
Sequence:CCGGCTCTAGAGATCAAGCAGTTTCCTCGAGGAAACTGCTTGATCTCTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024166.6-661s21c1
Sequence:CCGGCAGGATTGCAAATGGTTTAATCTCGAGATTAAACCATTTGCAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024166.6-661s1c1
Sequence:CCGGCAGGATTGCAAATGGTTTAATCTCGAGATTAAACCATTTGCAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024166.6-738s21c1
Sequence:CCGGACAAGTGTGGACCCTTATATTCTCGAGAATATAAGGGTCCACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183263    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024166.4-708s1c1
Sequence:CCGGGATGTAACATTGGTTCTGTATCTCGAGATACAGAACCAATGTTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180376    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024166.4-737s1c1
Sequence:CCGGGTACAAGTGTGGACCCTTATACTCGAGTATAAGGGTCCACACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024166.4-565s1c1
Sequence:CCGGGACCTTGCTCTCTAGAGATCACTCGAGTGATCTCTAGAGAGCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024166
VALIDATED
CHCHD2 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024166.6-604s21c1
Sequence:CCGGTCAGAACCAGAGCGATGTCAACTCGAGTTGACATCGCTCTGGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024166.6-500s21c1
Sequence:CCGGGCAAAGCCCGACATCACTTACCTCGAGGTAAGTGATGTCGGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024166.6-573s21c1
Sequence:CCGGCTCTAGAGATCAAGCAGTTTCCTCGAGGAAACTGCTTGATCTCTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024166.6-661s21c1
Sequence:CCGGCAGGATTGCAAATGGTTTAATCTCGAGATTAAACCATTTGCAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024166.6-661s1c1
Sequence:CCGGCAGGATTGCAAATGGTTTAATCTCGAGATTAAACCATTTGCAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024166.6-738s21c1
Sequence:CCGGACAAGTGTGGACCCTTATATTCTCGAGAATATAAGGGTCCACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183263    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024166.4-708s1c1
Sequence:CCGGGATGTAACATTGGTTCTGTATCTCGAGATACAGAACCAATGTTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180376    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024166.4-737s1c1
Sequence:CCGGGTACAAGTGTGGACCCTTATACTCGAGTATAAGGGTCCACACTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024166.4-565s1c1
Sequence:CCGGGACCTTGCTCTCTAGAGATCACTCGAGTGATCTCTAGAGAGCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks