EMAIL THIS PAGE TO A FRIEND

CHCHD2P10

coiled-coil-helix-coiled-coil-helix domain containing 2 pseudogene 10

Gene Product Result for
Species: Human CHCHD2P10(392221)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_373252
CHCHD2P10 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 2 pseudogene 10
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-337s1c1
Sequence:CCGGCCTTGTTTCCATGAGATCAAACTCGAGTTTGATCTCATGGAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-341s1c1
Sequence:CCGGGTTTCCATGAGATCAAACAGTCTCGAGACTGTTTGATCTCATGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-246s1c1
Sequence:CCGGGAGCTTCAGTGGAGGAAGTAACTCGAGTTACTTCCTCCACTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-260s1c2
Sequence:CCGGGAAGTAATGGTGAGCCTGCAACTCGAGTTGCAGGCTCACCATTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-333s1c1
Sequence:CCGGGCAGCCTTGTTTCCATGAGATCTCGAGATCTCATGGAAACAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-334s1c1
Sequence:CCGGCAGCCTTGTTTCCATGAGATCCTCGAGGATCTCATGGAAACAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_373252
CHCHD2P10 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 2 pseudogene 10
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-337s1c1
Sequence:CCGGCCTTGTTTCCATGAGATCAAACTCGAGTTTGATCTCATGGAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-341s1c1
Sequence:CCGGGTTTCCATGAGATCAAACAGTCTCGAGACTGTTTGATCTCATGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-246s1c1
Sequence:CCGGGAGCTTCAGTGGAGGAAGTAACTCGAGTTACTTCCTCCACTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-260s1c2
Sequence:CCGGGAAGTAATGGTGAGCCTGCAACTCGAGTTGCAGGCTCACCATTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-333s1c1
Sequence:CCGGGCAGCCTTGTTTCCATGAGATCTCGAGATCTCATGGAAACAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-334s1c1
Sequence:CCGGCAGCCTTGTTTCCATGAGATCCTCGAGGATCTCATGGAAACAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_373252
CHCHD2P10 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 2 pseudogene 10
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-337s1c1
Sequence:CCGGCCTTGTTTCCATGAGATCAAACTCGAGTTTGATCTCATGGAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-341s1c1
Sequence:CCGGGTTTCCATGAGATCAAACAGTCTCGAGACTGTTTGATCTCATGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-246s1c1
Sequence:CCGGGAGCTTCAGTGGAGGAAGTAACTCGAGTTACTTCCTCCACTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-260s1c2
Sequence:CCGGGAAGTAATGGTGAGCCTGCAACTCGAGTTGCAGGCTCACCATTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-333s1c1
Sequence:CCGGGCAGCCTTGTTTCCATGAGATCTCGAGATCTCATGGAAACAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_373252.1-334s1c1
Sequence:CCGGCAGCCTTGTTTCCATGAGATCCTCGAGGATCTCATGGAAACAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks