EMAIL THIS PAGE TO A FRIEND

CHCHD2P9

coiled-coil-helix-coiled-coil-helix domain containing 2 pseudogene 9

14 Gene Product Result for
Synonyms: C9orf49 CHCHD9
Species: Human CHCHD2P9(645345)
UniProtKB ID: Q5T1J5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010916 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010916 Rosetta Predictions human pricing
XM_928381 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305900 predicted 239
2 SASI_Hs02_00305901 predicted 355
3 SASI_Hs02_00305902 predicted 258
4 SASI_Hs02_00305903 predicted 417
5 SASI_Hs02_00305904 predicted 424
6 SASI_Hs02_00305905 predicted 421
7 SASI_Hs02_00305906 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265528 predicted 263
2 SASI_Hs01_00265529 predicted 372
3 SASI_Hs01_00265530 predicted 274
4 SASI_Hs01_00265531 predicted 444
5 SASI_Hs01_00265532 predicted 440
6 SASI_Hs01_00265533 predicted 436
7 SASI_Hs01_00265534 predicted 431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010916
CHCHD2P9 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 2 pseudogene 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010916.1-603s1c1
Sequence:CCGGCCTAGCTTCCTTGCTTCAGAACTCGAGTTCTGAAGCAAGGAAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010916.1-277s1c1
Sequence:CCGGCAGTGGAGGAAGTAATGCTGACTCGAGTCAGCATTACTTCCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159240    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010916.1-549s1c1
Sequence:CCGGGAATTGATAGTGAGGGTATAACTCGAGTTATACCCTCACTATCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010916.1-424s1c1
Sequence:CCGGCTGTGAGGATTTCAGTAAGGTCTCGAGACCTTACTGAAATCCTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010916.1-421s1c1
Sequence:CCGGGCTCTGTGAGGATTTCAGTAACTCGAGTTACTGAAATCCTCACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010916
CHCHD2P9 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 2 pseudogene 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010916.1-603s1c1
Sequence:CCGGCCTAGCTTCCTTGCTTCAGAACTCGAGTTCTGAAGCAAGGAAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010916.1-277s1c1
Sequence:CCGGCAGTGGAGGAAGTAATGCTGACTCGAGTCAGCATTACTTCCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159240    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010916.1-549s1c1
Sequence:CCGGGAATTGATAGTGAGGGTATAACTCGAGTTATACCCTCACTATCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010916.1-424s1c1
Sequence:CCGGCTGTGAGGATTTCAGTAAGGTCTCGAGACCTTACTGAAATCCTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010916.1-421s1c1
Sequence:CCGGGCTCTGTGAGGATTTCAGTAACTCGAGTTACTGAAATCCTCACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010916
CHCHD2P9 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 2 pseudogene 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010916.1-603s1c1
Sequence:CCGGCCTAGCTTCCTTGCTTCAGAACTCGAGTTCTGAAGCAAGGAAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010916.1-277s1c1
Sequence:CCGGCAGTGGAGGAAGTAATGCTGACTCGAGTCAGCATTACTTCCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159240    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010916.1-549s1c1
Sequence:CCGGGAATTGATAGTGAGGGTATAACTCGAGTTATACCCTCACTATCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010916.1-424s1c1
Sequence:CCGGCTGTGAGGATTTCAGTAAGGTCTCGAGACCTTACTGAAATCCTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010916.1-421s1c1
Sequence:CCGGGCTCTGTGAGGATTTCAGTAACTCGAGTTACTGAAATCCTCACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks