EMAIL THIS PAGE TO A FRIEND

CHCHD3

coiled-coil-helix-coiled-coil-helix domain containing 3

66 Gene Product Result for
Synonyms: MINOS3 PPP1R22
UniProtKB ID: Q9NX63
Gene ID:
Mouse(66075) coiled-coil-helix-coiled-coil-helix domain containing 3
Rat(296966) coiled-coil-helix-coiled-coil-helix domain containing 3
Zebrafish(407730) coiled-coil-helix-coiled-coil-helix domain containing 3
chicken(418435) coiled-coil-helix-coiled-coil-helix domain containing 3
cow(616477) coiled-coil-helix-coiled-coil-helix domain containing 3
domestic cat(101094661) coiled-coil-helix-coiled-coil-helix domain containing 3
dog(607574) coiled-coil-helix-coiled-coil-helix domain containing 3
naked mole-rat(101722598) coiled-coil-helix-coiled-coil-helix domain containing 3
domestic guinea pig(100727304) coiled-coil-helix-coiled-coil-helix domain containing 3
sheep(100145872) coiled-coil-helix-coiled-coil-helix domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017812 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025336 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025336 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025336 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017812 Rosetta Predictions human pricing
NM_001106588 Rosetta Predictions rat pricing
NM_025336 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169684 predicted 476
2 SASI_Hs01_00169685 predicted 578
3 SASI_Hs01_00169686 predicted 638
4 SASI_Hs01_00169687 predicted 282
5 SASI_Hs01_00169688 predicted 594
6 SASI_Hs02_00350676 predicted 299
7 SASI_Hs01_00169689 predicted 256
8 SASI_Hs01_00169690 predicted 1296
9 SASI_Hs01_00169691 predicted 597
10 SASI_Hs01_00169692 predicted 478
11 SASI_Hs01_00169683 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106588 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220428 predicted 653
2 SASI_Rn02_00220429 predicted 279
3 SASI_Rn02_00220430 predicted 309
4 SASI_Rn02_00220431 predicted 485
5 SASI_Rn02_00220432 predicted 602
6 SASI_Rn02_00220433 predicted 293
7 SASI_Rn02_00220434 predicted 321
8 SASI_Rn02_00220435 predicted 208
9 SASI_Rn02_00220436 predicted 1117
10 SASI_Rn02_00220437 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025336 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043064 predicted 943
2 SASI_Mm01_00043065 predicted 222
3 SASI_Mm01_00043066 predicted 954
4 SASI_Mm01_00043067 predicted 234
5 SASI_Mm01_00043068 predicted 211
6 SASI_Mm01_00043069 predicted 586
7 SASI_Mm01_00043070 predicted 549
8 SASI_Mm01_00043071 predicted 195
9 SASI_Mm01_00043072 predicted 417
10 SASI_Mm01_00043073 predicted 579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017812
VALIDATED
CHCHD3 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 3
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017812.1-178s1c1
Sequence:CCGGCGGACGAGAATGAGAACATCACTCGAGTGATGTTCTCATTCTCGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017812.1-240s1c1
Sequence:CCGGCGAATGAAGGAATCCTCTCCACTCGAGTGGAGAGGATTCCTTCATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017812.1-1359s1c1
Sequence:CCGGCCTTTGATTATGTAAGAGCTACTCGAGTAGCTCTTACATAATCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017812.1-1043s1c1
Sequence:CCGGGAGTATTAGTAAACCCTCTTACTCGAGTAAGAGGGTTTACTAATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017812.1-374s1c1
Sequence:CCGGCGAAGATCAGAAACGACTAAACTCGAGTTTAGTCGTTTCTGATCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017812.1-959s1c1
Sequence:CCGGCAGCAGAATCATTTCACGTTTCTCGAGAAACGTGAAATGATTCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017812.1-301s1c1
Sequence:CCGGCCTCAGTTTCTGATGAAGAATCTCGAGATTCTTCATCAGAAACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017812.1-531s1c1
Sequence:CCGGCGAGTGCTAAAGAAGCAGGATCTCGAGATCCTGCTTCTTTAGCACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017812.1-276s1c1
Sequence:CCGGCAGCGGTATTCTGGTGCTTATCTCGAGATAAGCACCAGAATACCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017812.1-348s1c1
Sequence:CCGGGCATTGGAGCAAGCCAAGAAACTCGAGTTTCTTGGCTTGCTCCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017812.1-773s1c1
Sequence:CCGGGCACTGTGTCAATCATGCCAACTCGAGTTGGCATGATTGACACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017812.2-1042s21c1
Sequence:CCGGGAGTATTAGTAAACCCTCTTACTCGAGTAAGAGGGTTTACTAATACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017812.2-958s21c1
Sequence:CCGGCAGCAGAATCATTTCACGTTTCTCGAGAAACGTGAAATGATTCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_017812.2-347s21c1
Sequence:CCGGGCATTGGAGCAAGCCAAGAAACTCGAGTTTCTTGGCTTGCTCCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017812.2-373s21c1
Sequence:CCGGCGAAGATCAGAAACGACTAAACTCGAGTTTAGTCGTTTCTGATCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_017812.2-300s21c1
Sequence:CCGGCCTCAGTTTCTGATGAAGAATCTCGAGATTCTTCATCAGAAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017812
VALIDATED
CHCHD3 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 3
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017812.1-178s1c1
Sequence:CCGGCGGACGAGAATGAGAACATCACTCGAGTGATGTTCTCATTCTCGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017812.1-240s1c1
Sequence:CCGGCGAATGAAGGAATCCTCTCCACTCGAGTGGAGAGGATTCCTTCATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017812.1-1359s1c1
Sequence:CCGGCCTTTGATTATGTAAGAGCTACTCGAGTAGCTCTTACATAATCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017812.1-1043s1c1
Sequence:CCGGGAGTATTAGTAAACCCTCTTACTCGAGTAAGAGGGTTTACTAATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017812.1-374s1c1
Sequence:CCGGCGAAGATCAGAAACGACTAAACTCGAGTTTAGTCGTTTCTGATCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017812.1-959s1c1
Sequence:CCGGCAGCAGAATCATTTCACGTTTCTCGAGAAACGTGAAATGATTCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017812.1-301s1c1
Sequence:CCGGCCTCAGTTTCTGATGAAGAATCTCGAGATTCTTCATCAGAAACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017812.1-531s1c1
Sequence:CCGGCGAGTGCTAAAGAAGCAGGATCTCGAGATCCTGCTTCTTTAGCACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017812.1-276s1c1
Sequence:CCGGCAGCGGTATTCTGGTGCTTATCTCGAGATAAGCACCAGAATACCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017812.1-348s1c1
Sequence:CCGGGCATTGGAGCAAGCCAAGAAACTCGAGTTTCTTGGCTTGCTCCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017812.1-773s1c1
Sequence:CCGGGCACTGTGTCAATCATGCCAACTCGAGTTGGCATGATTGACACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017812.2-1042s21c1
Sequence:CCGGGAGTATTAGTAAACCCTCTTACTCGAGTAAGAGGGTTTACTAATACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017812.2-958s21c1
Sequence:CCGGCAGCAGAATCATTTCACGTTTCTCGAGAAACGTGAAATGATTCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_017812.2-347s21c1
Sequence:CCGGGCATTGGAGCAAGCCAAGAAACTCGAGTTTCTTGGCTTGCTCCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017812.2-373s21c1
Sequence:CCGGCGAAGATCAGAAACGACTAAACTCGAGTTTAGTCGTTTCTGATCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_017812.2-300s21c1
Sequence:CCGGCCTCAGTTTCTGATGAAGAATCTCGAGATTCTTCATCAGAAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017812
VALIDATED
CHCHD3 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 3
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017812.1-178s1c1
Sequence:CCGGCGGACGAGAATGAGAACATCACTCGAGTGATGTTCTCATTCTCGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017812.1-240s1c1
Sequence:CCGGCGAATGAAGGAATCCTCTCCACTCGAGTGGAGAGGATTCCTTCATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017812.1-1359s1c1
Sequence:CCGGCCTTTGATTATGTAAGAGCTACTCGAGTAGCTCTTACATAATCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017812.1-1043s1c1
Sequence:CCGGGAGTATTAGTAAACCCTCTTACTCGAGTAAGAGGGTTTACTAATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017812.1-374s1c1
Sequence:CCGGCGAAGATCAGAAACGACTAAACTCGAGTTTAGTCGTTTCTGATCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017812.1-959s1c1
Sequence:CCGGCAGCAGAATCATTTCACGTTTCTCGAGAAACGTGAAATGATTCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017812.1-301s1c1
Sequence:CCGGCCTCAGTTTCTGATGAAGAATCTCGAGATTCTTCATCAGAAACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017812.1-531s1c1
Sequence:CCGGCGAGTGCTAAAGAAGCAGGATCTCGAGATCCTGCTTCTTTAGCACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017812.1-276s1c1
Sequence:CCGGCAGCGGTATTCTGGTGCTTATCTCGAGATAAGCACCAGAATACCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017812.1-348s1c1
Sequence:CCGGGCATTGGAGCAAGCCAAGAAACTCGAGTTTCTTGGCTTGCTCCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017812.1-773s1c1
Sequence:CCGGGCACTGTGTCAATCATGCCAACTCGAGTTGGCATGATTGACACAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017812.2-1042s21c1
Sequence:CCGGGAGTATTAGTAAACCCTCTTACTCGAGTAAGAGGGTTTACTAATACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017812.2-958s21c1
Sequence:CCGGCAGCAGAATCATTTCACGTTTCTCGAGAAACGTGAAATGATTCTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_017812.2-347s21c1
Sequence:CCGGGCATTGGAGCAAGCCAAGAAACTCGAGTTTCTTGGCTTGCTCCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017812.2-373s21c1
Sequence:CCGGCGAAGATCAGAAACGACTAAACTCGAGTTTAGTCGTTTCTGATCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_017812.2-300s21c1
Sequence:CCGGCCTCAGTTTCTGATGAAGAATCTCGAGATTCTTCATCAGAAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025336
VALIDATED
CHCHD3 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190651    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025336.1-926s1c1
Sequence:CCGGGCCATGTTCTAGATCAGCGATCTCGAGATCGCTGATCTAGAACATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025336.1-385s1c1
Sequence:CCGGGCTGTCCTTCGGGAAAGAATACTCGAGTATTCTTTCCCGAAGGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025336.1-737s21c1
Sequence:CCGGTGCTGGAGAAGGGAGGCTAAACTCGAGTTTAGCCTCCCTTCTCCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025336.1-880s21c1
Sequence:CCGGATGGACTCAACTGAATCATAACTCGAGTTATGATTCAGTTGAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025336.1-588s21c1
Sequence:CCGGCAAGTTCAAGCGGTATGAATACTCGAGTATTCATACCGCTTGAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025336.1-642s21c1
Sequence:CCGGCCTCCAGTGTTACCGTCAGAACTCGAGTTCTGACGGTAACACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025336.1-685s21c1
Sequence:CCGGTCTGCTCTGGCTAGCCAATACCTCGAGGTATTGGCTAGCCAGAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025336
VALIDATED
CHCHD3 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190651    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025336.1-926s1c1
Sequence:CCGGGCCATGTTCTAGATCAGCGATCTCGAGATCGCTGATCTAGAACATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025336.1-385s1c1
Sequence:CCGGGCTGTCCTTCGGGAAAGAATACTCGAGTATTCTTTCCCGAAGGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025336.1-737s21c1
Sequence:CCGGTGCTGGAGAAGGGAGGCTAAACTCGAGTTTAGCCTCCCTTCTCCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025336.1-880s21c1
Sequence:CCGGATGGACTCAACTGAATCATAACTCGAGTTATGATTCAGTTGAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025336.1-588s21c1
Sequence:CCGGCAAGTTCAAGCGGTATGAATACTCGAGTATTCATACCGCTTGAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025336.1-642s21c1
Sequence:CCGGCCTCCAGTGTTACCGTCAGAACTCGAGTTCTGACGGTAACACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025336.1-685s21c1
Sequence:CCGGTCTGCTCTGGCTAGCCAATACCTCGAGGTATTGGCTAGCCAGAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025336
VALIDATED
CHCHD3 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190651    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025336.1-926s1c1
Sequence:CCGGGCCATGTTCTAGATCAGCGATCTCGAGATCGCTGATCTAGAACATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025336.1-385s1c1
Sequence:CCGGGCTGTCCTTCGGGAAAGAATACTCGAGTATTCTTTCCCGAAGGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025336.1-737s21c1
Sequence:CCGGTGCTGGAGAAGGGAGGCTAAACTCGAGTTTAGCCTCCCTTCTCCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025336.1-880s21c1
Sequence:CCGGATGGACTCAACTGAATCATAACTCGAGTTATGATTCAGTTGAGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025336.1-588s21c1
Sequence:CCGGCAAGTTCAAGCGGTATGAATACTCGAGTATTCATACCGCTTGAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025336.1-642s21c1
Sequence:CCGGCCTCCAGTGTTACCGTCAGAACTCGAGTTCTGACGGTAACACTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025336.1-685s21c1
Sequence:CCGGTCTGCTCTGGCTAGCCAATACCTCGAGGTATTGGCTAGCCAGAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)