EMAIL THIS PAGE TO A FRIEND

CHCHD4

coiled-coil-helix-coiled-coil-helix domain containing 4

117 Gene Product Result for
Synonyms: MIA40 TIMM40
UniProtKB ID: Q8N4Q1, A8K3Z9, Q96AI2, Q96MY6
Gene ID:
Human(131474) Summary: CHCHD4, a component of human mitochondria, belongs to a protein family whose members share 6 highly conserved cysteine residues constituting a -CXC-CX(9)C-CX(9)C- motif in the C terminus (Hofmann et al., 2005 [PubMed 16185709]
Mouse(72170) coiled-coil-helix-coiled-coil-helix domain containing 4
Rat(312559) coiled-coil-helix-coiled-coil-helix domain containing 4
Zebrafish(445144) coiled-coil-helix-coiled-coil-helix domain containing 4
dog(476520) coiled-coil-helix-coiled-coil-helix domain containing 4
cow(513889) coiled-coil-helix-coiled-coil-helix domain containing 4
domestic cat(101081126) coiled-coil-helix-coiled-coil-helix domain containing 4
chicken(416037) coiled-coil-helix-coiled-coil-helix domain containing 4
sheep(101105782) coiled-coil-helix-coiled-coil-helix domain containing 4
domestic guinea pig(100723885) coiled-coil-helix-coiled-coil-helix domain containing 4
naked mole-rat(101709269) coiled-coil-helix-coiled-coil-helix domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133928 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133928 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133928 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144636 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098502 Rosetta Predictions human pricing
NM_144636 Rosetta Predictions human pricing
NM_001013431 Rosetta Predictions rat pricing
NM_133928 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319097 predicted 1098
2 SASI_Hs02_00319098 predicted 921
3 SASI_Hs02_00319099 predicted 1060
4 SASI_Hs02_00319100 predicted 953
5 SASI_Hs02_00319101 predicted 943
6 SASI_Hs02_00319102 predicted 924
7 SASI_Hs02_00319103 predicted 935
8 SASI_Hs02_00319104 predicted 773
9 SASI_Hs02_00319105 predicted 808
10 SASI_Hs02_00319106 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023643 predicted 1267
2 SASI_Hs01_00023644 predicted 1087
3 SASI_Hs01_00023645 predicted 1231
4 SASI_Hs01_00023649 predicted 1120
5 SASI_Hs02_00364478 predicted 1111
6 SASI_Hs01_00023651 predicted 1097
7 SASI_Hs01_00023652 predicted 1107
8 SASI_Hs02_00364479 predicted 939
9 SASI_Hs01_00023646 predicted 977
10 SASI_Hs02_00364480 predicted 1127
11 SASI_Hs01_00023647 predicted 1024
12 SASI_Hs01_00023648 predicted 345
13 SASI_Hs01_00023650 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013431 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201103 predicted 716
2 SASI_Rn01_00075836 predicted 782
3 SASI_Rn01_00075837 predicted 406
4 SASI_Rn02_00201104 predicted 624
5 SASI_Rn01_00075839 predicted 299
6 SASI_Rn01_00075840 predicted 291
7 SASI_Rn01_00075841 predicted 610
8 SASI_Rn01_00075842 predicted 723
9 SASI_Rn01_00075843 predicted 647
10 SASI_Rn01_00075844 predicted 279
11 SASI_Rn01_00075835 predicted 202
12 SASI_Rn01_00075838 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142205 predicted 211
2 SASI_Mm02_00339028 predicted 348
3 SASI_Mm02_00339029 predicted 806
4 SASI_Mm01_00142207 predicted 667
5 SASI_Mm01_00142208 predicted 969
6 SASI_Mm01_00142209 predicted 979
7 SASI_Mm01_00142210 predicted 204
8 SASI_Mm01_00142212 predicted 233
9 SASI_Mm02_00339030 predicted 492
10 SASI_Mm01_00142214 predicted 527
11 SASI_Mm01_00142206 predicted 817
12 SASI_Mm01_00142211 predicted 662
13 SASI_Mm01_00142213 predicted 907
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133928
VALIDATED
CHCHD4 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133928.2-450s21c1
Sequence:CCGGGAGGAGACAGCTGACACTAAGCTCGAGCTTAGTGTCAGCTGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133928.2-805s21c1
Sequence:CCGGTCGTGAGAAAGCTGATCTATTCTCGAGAATAGATCAGCTTTCTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133928.2-212s1c1
Sequence:CCGGGATACTGCCTAACGGAGATATCTCGAGATATCTCCGTTAGGCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133928.2-131s21c1
Sequence:CCGGGACCAAAGAAGACCATGAAACCTCGAGGTTTCATGGTCTTCTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133928.2-214s21c1
Sequence:CCGGTACTGCCTAACGGAGATATTACTCGAGTAATATCTCCGTTAGGCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133928.2-382s21c1
Sequence:CCGGAGAAGTACCCGGACCTCTATCCTCGAGGATAGAGGTCCGGGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133928.1-117s1c1
Sequence:CCGGCGGATCATATTTGTGACCAAACTCGAGTTTGGTCACAAATATGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133928.1-319s1c1
Sequence:CCGGGCACAGAGGATATCAAGGGATCTCGAGATCCCTTGATATCCTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133928
VALIDATED
CHCHD4 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133928.2-450s21c1
Sequence:CCGGGAGGAGACAGCTGACACTAAGCTCGAGCTTAGTGTCAGCTGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133928.2-805s21c1
Sequence:CCGGTCGTGAGAAAGCTGATCTATTCTCGAGAATAGATCAGCTTTCTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133928.2-212s1c1
Sequence:CCGGGATACTGCCTAACGGAGATATCTCGAGATATCTCCGTTAGGCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133928.2-131s21c1
Sequence:CCGGGACCAAAGAAGACCATGAAACCTCGAGGTTTCATGGTCTTCTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133928.2-214s21c1
Sequence:CCGGTACTGCCTAACGGAGATATTACTCGAGTAATATCTCCGTTAGGCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133928.2-382s21c1
Sequence:CCGGAGAAGTACCCGGACCTCTATCCTCGAGGATAGAGGTCCGGGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133928.1-117s1c1
Sequence:CCGGCGGATCATATTTGTGACCAAACTCGAGTTTGGTCACAAATATGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133928.1-319s1c1
Sequence:CCGGGCACAGAGGATATCAAGGGATCTCGAGATCCCTTGATATCCTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133928
VALIDATED
CHCHD4 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133928.2-450s21c1
Sequence:CCGGGAGGAGACAGCTGACACTAAGCTCGAGCTTAGTGTCAGCTGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133928.2-805s21c1
Sequence:CCGGTCGTGAGAAAGCTGATCTATTCTCGAGAATAGATCAGCTTTCTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133928.2-212s1c1
Sequence:CCGGGATACTGCCTAACGGAGATATCTCGAGATATCTCCGTTAGGCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133928.2-131s21c1
Sequence:CCGGGACCAAAGAAGACCATGAAACCTCGAGGTTTCATGGTCTTCTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133928.2-214s21c1
Sequence:CCGGTACTGCCTAACGGAGATATTACTCGAGTAATATCTCCGTTAGGCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133928.2-382s21c1
Sequence:CCGGAGAAGTACCCGGACCTCTATCCTCGAGGATAGAGGTCCGGGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133928.1-117s1c1
Sequence:CCGGCGGATCATATTTGTGACCAAACTCGAGTTTGGTCACAAATATGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133928.1-319s1c1
Sequence:CCGGGCACAGAGGATATCAAGGGATCTCGAGATCCCTTGATATCCTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144636
VALIDATED
CHCHD4 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_144636.2-484s21c1
Sequence:GTACCGGATGGATTGATACTGCCAAATGCTCGAGCATTTGGCAGTATCAATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144636.2-943s21c1
Sequence:CCGGTCTTGACATCTTGACATATACCTCGAGGTATATGTCAAGATGTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_144636.2-774s21c1
Sequence:CCGGGAAGAGGAGGGATCAAGTTAACTCGAGTTAACTTGATCCCTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_144636.2-552s21c1
Sequence:CCGGCCCTGTGGAGAACAGTTTAAGCTCGAGCTTAAACTGTTCTCCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_144636.2-387s21c1
Sequence:CCGGGGGAAGGATCGAATCATATTTCTCGAGAAATATGATTCGATCCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167346    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144636.1-1338s1c1
Sequence:CCGGCCATTCATAATCCCTTTCTAACTCGAGTTAGAAAGGGATTATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144636.1-686s1c1
Sequence:CCGGGCAGAAGAAACAGCTCCCATTCTCGAGAATGGGAGCTGTTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144636
VALIDATED
CHCHD4 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_144636.2-484s21c1
Sequence:GTACCGGATGGATTGATACTGCCAAATGCTCGAGCATTTGGCAGTATCAATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144636.2-943s21c1
Sequence:CCGGTCTTGACATCTTGACATATACCTCGAGGTATATGTCAAGATGTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_144636.2-774s21c1
Sequence:CCGGGAAGAGGAGGGATCAAGTTAACTCGAGTTAACTTGATCCCTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_144636.2-552s21c1
Sequence:CCGGCCCTGTGGAGAACAGTTTAAGCTCGAGCTTAAACTGTTCTCCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_144636.2-387s21c1
Sequence:CCGGGGGAAGGATCGAATCATATTTCTCGAGAAATATGATTCGATCCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167346    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144636.1-1338s1c1
Sequence:CCGGCCATTCATAATCCCTTTCTAACTCGAGTTAGAAAGGGATTATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144636.1-686s1c1
Sequence:CCGGGCAGAAGAAACAGCTCCCATTCTCGAGAATGGGAGCTGTTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144636
VALIDATED
CHCHD4 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_144636.2-484s21c1
Sequence:GTACCGGATGGATTGATACTGCCAAATGCTCGAGCATTTGGCAGTATCAATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144636.2-943s21c1
Sequence:CCGGTCTTGACATCTTGACATATACCTCGAGGTATATGTCAAGATGTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_144636.2-774s21c1
Sequence:CCGGGAAGAGGAGGGATCAAGTTAACTCGAGTTAACTTGATCCCTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_144636.2-552s21c1
Sequence:CCGGCCCTGTGGAGAACAGTTTAAGCTCGAGCTTAAACTGTTCTCCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_144636.2-387s21c1
Sequence:CCGGGGGAAGGATCGAATCATATTTCTCGAGAAATATGATTCGATCCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167346    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144636.1-1338s1c1
Sequence:CCGGCCATTCATAATCCCTTTCTAACTCGAGTTAGAAAGGGATTATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144636.1-686s1c1
Sequence:CCGGGCAGAAGAAACAGCTCCCATTCTCGAGAATGGGAGCTGTTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks