EMAIL THIS PAGE TO A FRIEND

CHCHD5

coiled-coil-helix-coiled-coil-helix domain containing 5

104 Gene Product Result for
Synonyms: C2orf9 MIC14
UniProtKB ID: Q9BSY4, Q585T4
Gene ID:
Mouse(66170) coiled-coil-helix-coiled-coil-helix domain containing 5
Rat(296147) coiled-coil-helix-coiled-coil-helix domain containing 5
chicken(770886) coiled-coil-helix-coiled-coil-helix domain containing 5
dog(611820) coiled-coil-helix-coiled-coil-helix domain containing 5
domestic cat(101082145) coiled-coil-helix-coiled-coil-helix domain containing 5
cow(514560) coiled-coil-helix-coiled-coil-helix domain containing 5
naked mole-rat(101702158) coiled-coil-helix-coiled-coil-helix domain containing 5
domestic guinea pig(100723243) coiled-coil-helix-coiled-coil-helix domain containing 5
sheep(101113220) coiled-coil-helix-coiled-coil-helix domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032309 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032309 Rosetta Predictions human pricing
NM_001106509 Rosetta Predictions rat pricing
NM_025395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113798 predicted 283
2 SASI_Hs01_00113799 predicted 221
3 SASI_Hs01_00113800 predicted 325
4 SASI_Hs01_00113801 predicted 281
5 SASI_Hs01_00113802 predicted 273
6 SASI_Hs01_00113803 predicted 276
7 SASI_Hs01_00113804 predicted 282
8 SASI_Hs01_00113805 predicted 276
9 SASI_Hs01_00113806 predicted 311
10 SASI_Hs01_00113807 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106509 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219668 predicted 303
2 SASI_Rn02_00219669 predicted 214
3 SASI_Rn02_00219670 predicted 225
4 SASI_Rn02_00219671 predicted 218
5 SASI_Rn02_00219672 predicted 222
6 SASI_Rn02_00219673 predicted 255
7 SASI_Rn02_00219674 predicted 232
8 SASI_Rn02_00219675 predicted 212
9 SASI_Rn02_00219676 predicted 217
10 SASI_Rn02_00219677 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023779 predicted 473
2 SASI_Mm01_00023780 predicted 421
3 SASI_Mm01_00023781 predicted 776
4 SASI_Mm01_00023782 predicted 723
5 SASI_Mm01_00023783 predicted 390
6 SASI_Mm01_00023784 predicted 523
7 SASI_Mm02_00328145 predicted 818
8 SASI_Mm01_00023785 predicted 255
9 SASI_Mm01_00023786 predicted 852
10 SASI_Mm01_00023787 predicted 556
11 SASI_Mm01_00023788 predicted 230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025395
VALIDATED
CHCHD5 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025395.1-126s1c1
Sequence:CCGGCATCGAGATTGTCACCACCTTCTCGAGAAGGTGGTGACAATCTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025395.1-231s1c1
Sequence:CCGGGAGAAGTGTCTTCGCTTGAATCTCGAGATTCAAGCGAAGACACTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025395.1-130s1c1
Sequence:CCGGGAGATTGTCACCACCTTAAGACTCGAGTCTTAAGGTGGTGACAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025395.1-483s1c1
Sequence:CCGGCCTGGACATCAGGACACTAAACTCGAGTTTAGTGTCCTGATGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025395
VALIDATED
CHCHD5 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025395.1-126s1c1
Sequence:CCGGCATCGAGATTGTCACCACCTTCTCGAGAAGGTGGTGACAATCTCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025395.1-231s1c1
Sequence:CCGGGAGAAGTGTCTTCGCTTGAATCTCGAGATTCAAGCGAAGACACTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025395.1-130s1c1
Sequence:CCGGGAGATTGTCACCACCTTAAGACTCGAGTCTTAAGGTGGTGACAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025395.1-483s1c1
Sequence:CCGGCCTGGACATCAGGACACTAAACTCGAGTTTAGTGTCCTGATGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025395
VALIDATED
CHCHD5 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025395.1-126s1c1
Sequence:CCGGCATCGAGATTGTCACCACCTTCTCGAGAAGGTGGTGACAATCTCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025395.1-231s1c1
Sequence:CCGGGAGAAGTGTCTTCGCTTGAATCTCGAGATTCAAGCGAAGACACTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025395.1-130s1c1
Sequence:CCGGGAGATTGTCACCACCTTAAGACTCGAGTCTTAAGGTGGTGACAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025395.1-483s1c1
Sequence:CCGGCCTGGACATCAGGACACTAAACTCGAGTTTAGTGTCCTGATGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032309
VALIDATED
CHCHD5 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032309.2-417s21c1
Sequence:CCGGGGGCAACTGTGCAGAGCATATCTCGAGATATGCTCTGCACAGTTGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032309.2-293s21c1
Sequence:CCGGACTACCTTAAGATGAGCATTGCTCGAGCAATGCTCATCTTAAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032309.2-282s21c1
Sequence:CCGGGCGGGACTGTCACTACCTTAACTCGAGTTAAGGTAGTGACAGTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032309.2-373s21c1
Sequence:CCGGTTTGAGGCCTTCGAGGAGTGTCTCGAGACACTCCTCGAAGGCCTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032309.2-384s21c1
Sequence:CCGGCGAGGAGTGTCTTCGACAGAACTCGAGTTCTGTCGAAGACACTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032309
VALIDATED
CHCHD5 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032309.2-417s21c1
Sequence:CCGGGGGCAACTGTGCAGAGCATATCTCGAGATATGCTCTGCACAGTTGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032309.2-293s21c1
Sequence:CCGGACTACCTTAAGATGAGCATTGCTCGAGCAATGCTCATCTTAAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032309.2-282s21c1
Sequence:CCGGGCGGGACTGTCACTACCTTAACTCGAGTTAAGGTAGTGACAGTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032309.2-373s21c1
Sequence:CCGGTTTGAGGCCTTCGAGGAGTGTCTCGAGACACTCCTCGAAGGCCTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032309.2-384s21c1
Sequence:CCGGCGAGGAGTGTCTTCGACAGAACTCGAGTTCTGTCGAAGACACTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032309
VALIDATED
CHCHD5 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032309.2-417s21c1
Sequence:CCGGGGGCAACTGTGCAGAGCATATCTCGAGATATGCTCTGCACAGTTGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032309.2-293s21c1
Sequence:CCGGACTACCTTAAGATGAGCATTGCTCGAGCAATGCTCATCTTAAGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032309.2-282s21c1
Sequence:CCGGGCGGGACTGTCACTACCTTAACTCGAGTTAAGGTAGTGACAGTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_032309.2-373s21c1
Sequence:CCGGTTTGAGGCCTTCGAGGAGTGTCTCGAGACACTCCTCGAAGGCCTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032309.2-384s21c1
Sequence:CCGGCGAGGAGTGTCTTCGACAGAACTCGAGTTCTGTCGAAGACACTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)