EMAIL THIS PAGE TO A FRIEND

CHCHD6

coiled-coil-helix-coiled-coil-helix domain containing 6

78 Gene Product Result for
Synonyms: CHCM1 PPP1R23
UniProtKB ID: Q9BRQ6, D6R9U0, D6RIB4, H8Y0Y7
Gene ID:
Mouse(66098) coiled-coil-helix-coiled-coil-helix domain containing 6
Rat(297436) coiled-coil-helix-coiled-coil-helix domain containing 6
domestic guinea pig(100719563) coiled-coil-helix-coiled-coil-helix domain containing 6
naked mole-rat(101697996) coiled-coil-helix-coiled-coil-helix domain containing 6
chicken(416029) coiled-coil-helix-coiled-coil-helix domain containing 6
domestic cat(101092591) coiled-coil-helix-coiled-coil-helix domain containing 6
cow(615934) coiled-coil-helix-coiled-coil-helix domain containing 6
dog(476509) coiled-coil-helix-coiled-coil-helix domain containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025351 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025351 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025351 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032343 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032343 Rosetta Predictions human pricing
NM_001106608 Rosetta Predictions rat pricing
NM_025351 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187386 predicted 289
2 SASI_Hs01_00187387 predicted 483
3 SASI_Hs02_00359731 predicted 511
4 SASI_Hs01_00187389 predicted 550
5 SASI_Hs01_00187390 predicted 575
6 SASI_Hs01_00187391 predicted 317
7 SASI_Hs01_00187392 predicted 281
8 SASI_Hs01_00187393 predicted 531
9 SASI_Hs01_00187394 predicted 274
10 SASI_Hs01_00187395 predicted 456
11 SASI_Hs01_00187388 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220628 predicted 657
2 SASI_Rn02_00220629 predicted 289
3 SASI_Rn02_00220630 predicted 796
4 SASI_Rn02_00220631 predicted 570
5 SASI_Rn02_00220632 predicted 415
6 SASI_Rn02_00220633 predicted 334
7 SASI_Rn02_00220634 predicted 600
8 SASI_Rn02_00220635 predicted 400
9 SASI_Rn02_00220636 predicted 319
10 SASI_Rn02_00220637 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121811 predicted 813
2 SASI_Mm01_00121812 predicted 351
3 SASI_Mm01_00121813 predicted 425
4 SASI_Mm01_00121814 predicted 779
5 SASI_Mm01_00121815 predicted 331
6 SASI_Mm01_00121816 predicted 673
7 SASI_Mm01_00121817 predicted 573
8 SASI_Mm01_00121818 predicted 476
9 SASI_Mm02_00328021 predicted 515
10 SASI_Mm01_00121819 predicted 623
11 SASI_Mm01_00121820 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025351
VALIDATED
CHCHD6 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 6
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025351.2-427s21c1
Sequence:CCGGAGCAGTGAAGGAGGATCTTAACTCGAGTTAAGATCCTCCTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025351.2-694s21c1
Sequence:CCGGTAAACTGTCTTCCCAACAATTCTCGAGAATTGTTGGGAAGACAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025351.2-167s21c1
Sequence:CCGGAGTGTTGTGAACCGCATGAAGCTCGAGCTTCATGCGGTTCACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025351.2-917s21c1
Sequence:CCGGTGAAGAAGGGACCGATCATAGCTCGAGCTATGATCGGTCCCTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025351.2-812s1c1
Sequence:CCGGGACCATCTGCATGAAGTGCTTCTCGAGAAGCACTTCATGCAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025351.2-433s1c1
Sequence:CCGGGAAGGAGGATCTTAAGAAGTTCTCGAGAACTTCTTAAGATCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025351
VALIDATED
CHCHD6 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 6
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025351.2-427s21c1
Sequence:CCGGAGCAGTGAAGGAGGATCTTAACTCGAGTTAAGATCCTCCTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025351.2-694s21c1
Sequence:CCGGTAAACTGTCTTCCCAACAATTCTCGAGAATTGTTGGGAAGACAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025351.2-167s21c1
Sequence:CCGGAGTGTTGTGAACCGCATGAAGCTCGAGCTTCATGCGGTTCACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025351.2-917s21c1
Sequence:CCGGTGAAGAAGGGACCGATCATAGCTCGAGCTATGATCGGTCCCTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025351.2-812s1c1
Sequence:CCGGGACCATCTGCATGAAGTGCTTCTCGAGAAGCACTTCATGCAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025351.2-433s1c1
Sequence:CCGGGAAGGAGGATCTTAAGAAGTTCTCGAGAACTTCTTAAGATCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025351
VALIDATED
CHCHD6 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 6
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025351.2-427s21c1
Sequence:CCGGAGCAGTGAAGGAGGATCTTAACTCGAGTTAAGATCCTCCTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025351.2-694s21c1
Sequence:CCGGTAAACTGTCTTCCCAACAATTCTCGAGAATTGTTGGGAAGACAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025351.2-167s21c1
Sequence:CCGGAGTGTTGTGAACCGCATGAAGCTCGAGCTTCATGCGGTTCACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025351.2-917s21c1
Sequence:CCGGTGAAGAAGGGACCGATCATAGCTCGAGCTATGATCGGTCCCTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025351.2-812s1c1
Sequence:CCGGGACCATCTGCATGAAGTGCTTCTCGAGAAGCACTTCATGCAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025351.2-433s1c1
Sequence:CCGGGAAGGAGGATCTTAAGAAGTTCTCGAGAACTTCTTAAGATCCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032343
VALIDATED
CHCHD6 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 6
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032343.1-537s1c1
Sequence:CCGGGCTGAGATGTATAAACTGTCTCTCGAGAGACAGTTTATACATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032343.1-583s1c1
Sequence:CCGGCAAAGATGGAGAGCACAATAACTCGAGTTATTGTGCTCTCCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032343.1-527s1c1
Sequence:CCGGGAGGAAGAATGCTGAGATGTACTCGAGTACATCTCAGCATTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032343.1-199s1c1
Sequence:CCGGGCCTTCAAGATGGCAACTTGACTCGAGTCAAGTTGCCATCTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032343.1-580s1c1
Sequence:CCGGCCTCAAAGATGGAGAGCACAACTCGAGTTGTGCTCTCCATCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032343.1-194s1c1
Sequence:CCGGCTTTGGCCTTCAAGATGGCAACTCGAGTTGCCATCTTGAAGGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032343.1-299s1c1
Sequence:CCGGCAAGAGGTATGAACAGGAGCACTCGAGTGCTCCTGTTCATACCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_032343.1-317s1c1
Sequence:CCGGGCATGCTGCTATCCAGGATAACTCGAGTTATCCTGGATAGCAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032343.1-787s1c1
Sequence:CCGGCCTGAAGAAGGGACCAATCATCTCGAGATGATTGGTCCCTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032343.1-772s1c1
Sequence:CCGGGCAGTGACTTGGAGCCCTGAACTCGAGTTCAGGGCTCCAAGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_032343.1-516s1c1
Sequence:CCGGGAGCGTATTGAGAGGAAGAATCTCGAGATTCTTCCTCTCAATACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032343
VALIDATED
CHCHD6 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 6
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032343.1-537s1c1
Sequence:CCGGGCTGAGATGTATAAACTGTCTCTCGAGAGACAGTTTATACATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032343.1-583s1c1
Sequence:CCGGCAAAGATGGAGAGCACAATAACTCGAGTTATTGTGCTCTCCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032343.1-527s1c1
Sequence:CCGGGAGGAAGAATGCTGAGATGTACTCGAGTACATCTCAGCATTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032343.1-199s1c1
Sequence:CCGGGCCTTCAAGATGGCAACTTGACTCGAGTCAAGTTGCCATCTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032343.1-580s1c1
Sequence:CCGGCCTCAAAGATGGAGAGCACAACTCGAGTTGTGCTCTCCATCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032343.1-194s1c1
Sequence:CCGGCTTTGGCCTTCAAGATGGCAACTCGAGTTGCCATCTTGAAGGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032343.1-299s1c1
Sequence:CCGGCAAGAGGTATGAACAGGAGCACTCGAGTGCTCCTGTTCATACCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_032343.1-317s1c1
Sequence:CCGGGCATGCTGCTATCCAGGATAACTCGAGTTATCCTGGATAGCAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032343.1-787s1c1
Sequence:CCGGCCTGAAGAAGGGACCAATCATCTCGAGATGATTGGTCCCTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032343.1-772s1c1
Sequence:CCGGGCAGTGACTTGGAGCCCTGAACTCGAGTTCAGGGCTCCAAGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_032343.1-516s1c1
Sequence:CCGGGAGCGTATTGAGAGGAAGAATCTCGAGATTCTTCCTCTCAATACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032343
VALIDATED
CHCHD6 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 6
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032343.1-537s1c1
Sequence:CCGGGCTGAGATGTATAAACTGTCTCTCGAGAGACAGTTTATACATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032343.1-583s1c1
Sequence:CCGGCAAAGATGGAGAGCACAATAACTCGAGTTATTGTGCTCTCCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032343.1-527s1c1
Sequence:CCGGGAGGAAGAATGCTGAGATGTACTCGAGTACATCTCAGCATTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032343.1-199s1c1
Sequence:CCGGGCCTTCAAGATGGCAACTTGACTCGAGTCAAGTTGCCATCTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032343.1-580s1c1
Sequence:CCGGCCTCAAAGATGGAGAGCACAACTCGAGTTGTGCTCTCCATCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032343.1-194s1c1
Sequence:CCGGCTTTGGCCTTCAAGATGGCAACTCGAGTTGCCATCTTGAAGGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032343.1-299s1c1
Sequence:CCGGCAAGAGGTATGAACAGGAGCACTCGAGTGCTCCTGTTCATACCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_032343.1-317s1c1
Sequence:CCGGGCATGCTGCTATCCAGGATAACTCGAGTTATCCTGGATAGCAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032343.1-787s1c1
Sequence:CCGGCCTGAAGAAGGGACCAATCATCTCGAGATGATTGGTCCCTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032343.1-772s1c1
Sequence:CCGGGCAGTGACTTGGAGCCCTGAACTCGAGTTCAGGGCTCCAAGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_032343.1-516s1c1
Sequence:CCGGGAGCGTATTGAGAGGAAGAATCTCGAGATTCTTCCTCTCAATACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks