EMAIL THIS PAGE TO A FRIEND

CHCHD7

coiled-coil-helix-coiled-coil-helix domain containing 7

Synonyms: COX23
UniProtKB ID: Q9BUK0, A8K223, E9PBH3, J3KNE9, Q7Z588
Gene ID:
Mouse(66433) coiled-coil-helix-coiled-coil-helix domain containing 7
Rat(684258) coiled-coil-helix-coiled-coil-helix domain containing 7
Zebrafish(561510) coiled-coil-helix-coiled-coil-helix domain containing 7
chicken(770709) coiled-coil-helix-coiled-coil-helix domain containing 7
dog(609282) coiled-coil-helix-coiled-coil-helix domain containing 7
Horse(100052988) coiled-coil-helix-coiled-coil-helix domain containing 7
cow(616237) coiled-coil-helix-coiled-coil-helix domain containing 7
domestic cat(101097868) coiled-coil-helix-coiled-coil-helix domain containing 7
naked mole-rat(101725918) coiled-coil-helix-coiled-coil-helix domain containing 7
domestic guinea pig(100736100) coiled-coil-helix-coiled-coil-helix domain containing 7
sheep(101116061) coiled-coil-helix-coiled-coil-helix domain containing 7
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024300 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011667 Rosetta Predictions human pricing
NM_001011668 Rosetta Predictions human pricing
NM_001011669 Rosetta Predictions human pricing
NM_001011670 Rosetta Predictions human pricing
NM_001011671 Rosetta Predictions human pricing
NM_024300 Rosetta Predictions human pricing
XM_001069610 Rosetta Predictions rat pricing
NM_181391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028531 predicted 555
2 SASI_Hs02_00306011 predicted 640
3 SASI_Hs01_00028532 predicted 771
4 SASI_Hs01_00028533 predicted 735
5 SASI_Hs01_00028534 predicted 746
6 SASI_Hs01_00028536 predicted 718
7 SASI_Hs01_00028537 predicted 769
8 SASI_Hs01_00028538 predicted 741
9 SASI_Hs01_00028539 predicted 836
10 SASI_Hs01_00028540 predicted 729
11 SASI_Hs01_00028535 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306012 predicted 599
2 SASI_Hs02_00306013 predicted 729
3 SASI_Hs01_00106197 predicted 953
4 SASI_Hs01_00106199 predicted 698
5 SASI_Hs01_00106200 predicted 889
6 SASI_Hs01_00106201 predicted 907
7 SASI_Hs01_00106203 predicted 675
8 SASI_Hs01_00106204 predicted 726
9 SASI_Hs01_00106205 predicted 701
10 SASI_Hs01_00106206 predicted 796
11 SASI_Hs01_00106198 predicted 689
12 SASI_Hs01_00106202 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219816 predicted 540
2 SASI_Hs02_00306014 predicted 625
3 SASI_Hs01_00219817 predicted 755
4 SASI_Hs01_00219818 predicted 716
5 SASI_Hs01_00219819 predicted 717
6 SASI_Hs01_00219821 predicted 702
7 SASI_Hs01_00219822 predicted 743
8 SASI_Hs01_00219823 predicted 721
9 SASI_Hs01_00219824 predicted 813
10 SASI_Hs01_00219825 predicted 709
11 SASI_Hs01_00219820 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125076 predicted 414
2 SASI_Hs02_00306015 predicted 497
3 SASI_Hs01_00125077 predicted 623
4 SASI_Hs01_00125078 predicted 586
5 SASI_Hs01_00125079 predicted 593
6 SASI_Hs01_00125081 predicted 573
7 SASI_Hs01_00125082 predicted 619
8 SASI_Hs01_00125083 predicted 596
9 SASI_Hs01_00125084 predicted 688
10 SASI_Hs01_00125085 predicted 585
11 SASI_Hs01_00125080 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306016 predicted 451
2 SASI_Hs02_00306017 predicted 584
3 SASI_Hs01_00111268 predicted 807
4 SASI_Hs01_00111270 predicted 554
5 SASI_Hs01_00111271 predicted 737
6 SASI_Hs01_00111272 predicted 761
7 SASI_Hs01_00111274 predicted 528
8 SASI_Hs01_00111275 predicted 577
9 SASI_Hs01_00111276 predicted 550
10 SASI_Hs01_00111277 predicted 642
11 SASI_Hs01_00111269 predicted 546
12 SASI_Hs01_00111273 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356643 predicted 577
2 SASI_Hs02_00356644 predicted 710
3 SASI_Hs01_00067564 predicted 937
4 SASI_Hs01_00067565 predicted 681
5 SASI_Hs01_00067566 predicted 874
6 SASI_Hs01_00067567 predicted 893
7 SASI_Hs01_00067569 predicted 652
8 SASI_Hs01_00067570 predicted 698
9 SASI_Hs01_00067571 predicted 679
10 SASI_Hs01_00067572 predicted 776
11 SASI_Hs01_00067568 predicted 839
12 SASI_Hs01_00067573 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328682 predicted 210
2 SASI_Rn02_00328683 predicted 220
3 SASI_Rn02_00328684 predicted 198
4 SASI_Rn02_00328685 predicted 206
5 SASI_Rn02_00328686 predicted 204
6 SASI_Rn02_00328687 predicted 218
7 SASI_Rn02_00328688 predicted 204
8 SASI_Rn02_00328689 predicted 294
9 SASI_Rn02_00328690 predicted 264
10 SASI_Rn02_00328691 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100274 predicted 418
2 SASI_Mm01_00100275 predicted 394
3 SASI_Mm01_00100276 predicted 388
4 SASI_Mm01_00100277 predicted 406
5 SASI_Mm01_00100278 predicted 420
6 SASI_Mm01_00100279 predicted 399
7 SASI_Mm01_00100281 predicted 415
8 SASI_Mm01_00100283 predicted 381
9 SASI_Mm02_00349732 predicted 381
10 SASI_Mm02_00349733 predicted 431
11 SASI_Mm01_00100280 predicted 428
12 SASI_Mm01_00100282 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024300
VALIDATED
CHCHD7 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 7
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024300.2-359s1c1
Sequence:CCGGGAAAGAACGGAGTGAAGCCATCTCGAGATGGCTTCACTCCGTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024300.2-226s1c1
Sequence:CCGGCCTTGTTTGTCGGAATCTGATCTCGAGATCAGATTCCGACAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024300.2-297s1c1
Sequence:CCGGCACTTACTTCTTGAGGTACAACTCGAGTTGTACCTCAAGAAGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024300.2-419s1c1
Sequence:CCGGCAGTGGGAAATATGCCCTATTCTCGAGAATAGGGCATATTTCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024300.2-411s1c1
Sequence:CCGGCTTGAGAGCAGTGGGAAATATCTCGAGATATTTCCCACTGCTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024300.2-418s1c1
Sequence:CCGGGCAGTGGGAAATATGCCCTATCTCGAGATAGGGCATATTTCCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024300.2-282s1c1
Sequence:CCGGCAGGGAAAGGTGTTCCACTTACTCGAGTAAGTGGAACACCTTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024300.2-286s1c1
Sequence:CCGGGAAAGGTGTTCCACTTACTTCCTCGAGGAAGTAAGTGGAACACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024300.2-363s1c1
Sequence:CCGGGAACGGAGTGAAGCCATTTATCTCGAGATAAATGGCTTCACTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024300.2-406s1c1
Sequence:CCGGGAAATCTTGAGAGCAGTGGGACTCGAGTCCCACTGCTCTCAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024300.2-251s1c1
Sequence:CCGGCCACCAGATGTCTGGATGAAACTCGAGTTTCATCCAGACATCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024300
VALIDATED
CHCHD7 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 7
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024300.2-359s1c1
Sequence:CCGGGAAAGAACGGAGTGAAGCCATCTCGAGATGGCTTCACTCCGTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024300.2-226s1c1
Sequence:CCGGCCTTGTTTGTCGGAATCTGATCTCGAGATCAGATTCCGACAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024300.2-297s1c1
Sequence:CCGGCACTTACTTCTTGAGGTACAACTCGAGTTGTACCTCAAGAAGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024300.2-419s1c1
Sequence:CCGGCAGTGGGAAATATGCCCTATTCTCGAGAATAGGGCATATTTCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024300.2-411s1c1
Sequence:CCGGCTTGAGAGCAGTGGGAAATATCTCGAGATATTTCCCACTGCTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024300.2-418s1c1
Sequence:CCGGGCAGTGGGAAATATGCCCTATCTCGAGATAGGGCATATTTCCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024300.2-282s1c1
Sequence:CCGGCAGGGAAAGGTGTTCCACTTACTCGAGTAAGTGGAACACCTTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024300.2-286s1c1
Sequence:CCGGGAAAGGTGTTCCACTTACTTCCTCGAGGAAGTAAGTGGAACACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024300.2-363s1c1
Sequence:CCGGGAACGGAGTGAAGCCATTTATCTCGAGATAAATGGCTTCACTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024300.2-406s1c1
Sequence:CCGGGAAATCTTGAGAGCAGTGGGACTCGAGTCCCACTGCTCTCAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024300.2-251s1c1
Sequence:CCGGCCACCAGATGTCTGGATGAAACTCGAGTTTCATCCAGACATCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024300
VALIDATED
CHCHD7 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 7
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024300.2-359s1c1
Sequence:CCGGGAAAGAACGGAGTGAAGCCATCTCGAGATGGCTTCACTCCGTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024300.2-226s1c1
Sequence:CCGGCCTTGTTTGTCGGAATCTGATCTCGAGATCAGATTCCGACAAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024300.2-297s1c1
Sequence:CCGGCACTTACTTCTTGAGGTACAACTCGAGTTGTACCTCAAGAAGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024300.2-419s1c1
Sequence:CCGGCAGTGGGAAATATGCCCTATTCTCGAGAATAGGGCATATTTCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024300.2-411s1c1
Sequence:CCGGCTTGAGAGCAGTGGGAAATATCTCGAGATATTTCCCACTGCTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024300.2-418s1c1
Sequence:CCGGGCAGTGGGAAATATGCCCTATCTCGAGATAGGGCATATTTCCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024300.2-282s1c1
Sequence:CCGGCAGGGAAAGGTGTTCCACTTACTCGAGTAAGTGGAACACCTTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024300.2-286s1c1
Sequence:CCGGGAAAGGTGTTCCACTTACTTCCTCGAGGAAGTAAGTGGAACACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024300.2-363s1c1
Sequence:CCGGGAACGGAGTGAAGCCATTTATCTCGAGATAAATGGCTTCACTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024300.2-406s1c1
Sequence:CCGGGAAATCTTGAGAGCAGTGGGACTCGAGTCCCACTGCTCTCAAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024300.2-251s1c1
Sequence:CCGGCCACCAGATGTCTGGATGAAACTCGAGTTTCATCCAGACATCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181391
VALIDATED
CHCHD7 MISSION shRNA Bacterial Glycerol Stock
coiled-coil-helix-coiled-coil-helix domain containing 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181391.1-493s1c1
Sequence:CCGGCAGTTACTTCTTGAAGTACAACTCGAGTTGTACTTCAAGAAGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181391.1-422s1c1
Sequence:CCGGCCTTGCTTGTCGGAATCTGATCTCGAGATCAGATTCCGACAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181391.1-415s1c1
Sequence:CCGGCATAAACCCTTGCTTGTCGGACTCGAGTCCGACAAGCAAGGGTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181391.1-432s1c1
Sequence:CCGGCGGAATCTGATGCTTCTACCACTCGAGTGGTAGAAGCATCAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181391.1-487s1c1
Sequence:CCGGGTGTTCCAGTTACTTCTTGAACTCGAGTTCAAGAAGTAACTGGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181391.2-486s21c1
Sequence:CCGGGTGTTCCAGTTACTTCTTGAACTCGAGTTCAAGAAGTAACTGGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181391.2-431s21c1
Sequence:CCGGCGGAATCTGATGCTTCTACCACTCGAGTGGTAGAAGCATCAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181391.2-630s21c1
Sequence:CCGGCTACTGAGTATTTGCATTAAACTCGAGTTTAATGCAAATACTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181391.2-587s21c1
Sequence:CCGGCAGCAGAAAGAGACGAAATTTCTCGAGAAATTTCGTCTCTTTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181391.2-560s21c1
Sequence:CCGGATGGAGTTCAGCCATCTATGCCTCGAGGCATAGATGGCTGAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181391
VALIDATED
CHCHD7 MISSION shRNA shRNA Plasmid DNA
coiled-coil-helix-coiled-coil-helix domain containing 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181391.1-493s1c1
Sequence:CCGGCAGTTACTTCTTGAAGTACAACTCGAGTTGTACTTCAAGAAGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181391.1-422s1c1
Sequence:CCGGCCTTGCTTGTCGGAATCTGATCTCGAGATCAGATTCCGACAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181391.1-415s1c1
Sequence:CCGGCATAAACCCTTGCTTGTCGGACTCGAGTCCGACAAGCAAGGGTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181391.1-432s1c1
Sequence:CCGGCGGAATCTGATGCTTCTACCACTCGAGTGGTAGAAGCATCAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181391.1-487s1c1
Sequence:CCGGGTGTTCCAGTTACTTCTTGAACTCGAGTTCAAGAAGTAACTGGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181391.2-486s21c1
Sequence:CCGGGTGTTCCAGTTACTTCTTGAACTCGAGTTCAAGAAGTAACTGGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181391.2-431s21c1
Sequence:CCGGCGGAATCTGATGCTTCTACCACTCGAGTGGTAGAAGCATCAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181391.2-630s21c1
Sequence:CCGGCTACTGAGTATTTGCATTAAACTCGAGTTTAATGCAAATACTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181391.2-587s21c1
Sequence:CCGGCAGCAGAAAGAGACGAAATTTCTCGAGAAATTTCGTCTCTTTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181391.2-560s21c1
Sequence:CCGGATGGAGTTCAGCCATCTATGCCTCGAGGCATAGATGGCTGAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181391
VALIDATED
CHCHD7 MISSION shRNA Lentiviral Transduction Particles
coiled-coil-helix-coiled-coil-helix domain containing 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181391.1-493s1c1
Sequence:CCGGCAGTTACTTCTTGAAGTACAACTCGAGTTGTACTTCAAGAAGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181391.1-422s1c1
Sequence:CCGGCCTTGCTTGTCGGAATCTGATCTCGAGATCAGATTCCGACAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181391.1-415s1c1
Sequence:CCGGCATAAACCCTTGCTTGTCGGACTCGAGTCCGACAAGCAAGGGTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181391.1-432s1c1
Sequence:CCGGCGGAATCTGATGCTTCTACCACTCGAGTGGTAGAAGCATCAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_181391.1-487s1c1
Sequence:CCGGGTGTTCCAGTTACTTCTTGAACTCGAGTTCAAGAAGTAACTGGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181391.2-486s21c1
Sequence:CCGGGTGTTCCAGTTACTTCTTGAACTCGAGTTCAAGAAGTAACTGGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181391.2-431s21c1
Sequence:CCGGCGGAATCTGATGCTTCTACCACTCGAGTGGTAGAAGCATCAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181391.2-630s21c1
Sequence:CCGGCTACTGAGTATTTGCATTAAACTCGAGTTTAATGCAAATACTCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181391.2-587s21c1
Sequence:CCGGCAGCAGAAAGAGACGAAATTTCTCGAGAAATTTCGTCTCTTTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181391.2-560s21c1
Sequence:CCGGATGGAGTTCAGCCATCTATGCCTCGAGGCATAGATGGCTGAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks