EMAIL THIS PAGE TO A FRIEND

CHD1

chromodomain helicase DNA binding protein 1

140 Gene Product Result for
UniProtKB ID: O14646, Q17RZ3
Gene ID:
Human(1105) Summary: The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
Mouse(12648) chromodomain helicase DNA binding protein 1
Rat(308215) chromodomain helicase DNA binding protein 1
fruit fly(33505) Chromodomain-helicase-DNA-binding protein 1
chicken(395783) chromodomain helicase DNA binding protein 1
dog(488891) chromodomain helicase DNA binding protein 1
domestic cat(101089741) chromodomain helicase DNA binding protein 1
cow(505123) chromodomain helicase DNA binding protein 1
Horse(100064833) chromodomain helicase DNA binding protein 1
sheep(101111801) chromodomain helicase DNA binding protein 1
naked mole-rat(101713414) chromodomain helicase DNA binding protein 1
domestic guinea pig(100717330) chromodomain helicase DNA binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
CLLS1042 MCF10A CELLS CDH1 (-/-) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001270 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007690 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007690 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007690 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001270 Rosetta Predictions human pricing
NM_001107465 Rosetta Predictions rat pricing
NM_007690 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203194 predicted 4264
2 SASI_Hs02_00331472 predicted 4798
3 SASI_Hs01_00203195 predicted 4509
4 SASI_Hs02_00331473 predicted 3870
5 SASI_Hs01_00203197 predicted 3984
6 SASI_Hs01_00203198 predicted 1590
7 SASI_Hs01_00203199 predicted 2219
8 SASI_Hs02_00331474 predicted 204
9 SASI_Hs01_00203200 predicted 4902
10 SASI_Hs01_00203202 predicted 2981
11 SASI_Hs01_00203196 predicted 3011
12 SASI_Hs01_00203201 predicted 4974
13 SASI_Hs01_00203203 predicted 3685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229095 predicted 5106
2 SASI_Rn02_00229096 predicted 1049
3 SASI_Rn02_00229097 predicted 4700
4 SASI_Rn02_00229098 predicted 2052
5 SASI_Rn02_00229099 predicted 1683
6 SASI_Rn02_00229100 predicted 3800
7 SASI_Rn02_00229101 predicted 2005
8 SASI_Rn02_00229102 predicted 5013
9 SASI_Rn02_00229103 predicted 1318
10 SASI_Rn02_00229104 predicted 4513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040612 predicted 3551
2 SASI_Mm02_00312229 predicted 1537
3 SASI_Mm01_00040614 predicted 1338
4 SASI_Mm02_00312230 predicted 4821
5 SASI_Mm01_00040615 predicted 4508
6 SASI_Mm01_00040617 predicted 4954
7 SASI_Mm01_00040618 predicted 1832
8 SASI_Mm02_00312231 predicted 1177
9 SASI_Mm01_00040619 predicted 2234
10 SASI_Mm01_00040620 predicted 4127
11 SASI_Mm01_00040613 predicted 4953
12 SASI_Mm01_00040616 predicted 3945
13 SASI_Mm01_00040621 predicted 3541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001270
VALIDATED
CHD1 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001270.2-1313s21c1
Sequence:CCGGCAAATAGTGGAACGTATAATTCTCGAGAATTATACGTTCCACTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001270.2-5605s21c1
Sequence:CCGGTTTAGACTGACCTCCATTTAACTCGAGTTAAATGGAGGTCAGTCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001270.2-4802s21c1
Sequence:CCGGCAGTACCATGATCATCATAAACTCGAGTTTATGATGATCATGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001270.2-5329s21c1
Sequence:CCGGCATAAACCAACACAGTAATTGCTCGAGCAATTACTGTGTTGGTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001270.2-1450s21c1
Sequence:GTACCGGAGCATGCATTGATGAGTATTTCTCGAGAAATACTCATCAATGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001270.2-5411s21c1
Sequence:CCGGCCAGGATGCAAGGTCTATTATCTCGAGATAATAGACCTTGCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001270.2-5088s21c1
Sequence:CCGGCTGAATATACGCACCATAAATCTCGAGATTTATGGTGCGTATATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001270.2-4921s21c1
Sequence:CCGGCAAGCAAGACAGCAGATATTACTCGAGTAATATCTGCTGTCTTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001270.2-1987s21c1
Sequence:CCGGTGATGAAGCACACCGATTAAACTCGAGTTTAATCGGTGTGCTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001270.2-3741s21c1
Sequence:CCGGAGGGTCCAACATTCCGAATATCTCGAGATATTCGGAATGTTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001270.1-3559s1c1
Sequence:CCGGGCGGTTTATCAAGAGCTATAACTCGAGTTATAGCTCTTGATAAACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001270.1-1782s1c1
Sequence:CCGGCCACTCTTACTTCCTGGCAAACTCGAGTTTGCCAGGAAGTAAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001270.1-4915s1c1
Sequence:CCGGCCATCGTGATTGGGATCACTACTCGAGTAGTGATCCCAATCACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001270.1-681s1c1
Sequence:CCGGGCAGTTGTGATGAAACAGAATCTCGAGATTCTGTTTCATCACAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001270
VALIDATED
CHD1 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001270.2-1313s21c1
Sequence:CCGGCAAATAGTGGAACGTATAATTCTCGAGAATTATACGTTCCACTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001270.2-5605s21c1
Sequence:CCGGTTTAGACTGACCTCCATTTAACTCGAGTTAAATGGAGGTCAGTCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001270.2-4802s21c1
Sequence:CCGGCAGTACCATGATCATCATAAACTCGAGTTTATGATGATCATGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001270.2-5329s21c1
Sequence:CCGGCATAAACCAACACAGTAATTGCTCGAGCAATTACTGTGTTGGTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001270.2-1450s21c1
Sequence:GTACCGGAGCATGCATTGATGAGTATTTCTCGAGAAATACTCATCAATGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001270.2-5411s21c1
Sequence:CCGGCCAGGATGCAAGGTCTATTATCTCGAGATAATAGACCTTGCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001270.2-5088s21c1
Sequence:CCGGCTGAATATACGCACCATAAATCTCGAGATTTATGGTGCGTATATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001270.2-4921s21c1
Sequence:CCGGCAAGCAAGACAGCAGATATTACTCGAGTAATATCTGCTGTCTTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001270.2-1987s21c1
Sequence:CCGGTGATGAAGCACACCGATTAAACTCGAGTTTAATCGGTGTGCTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001270.2-3741s21c1
Sequence:CCGGAGGGTCCAACATTCCGAATATCTCGAGATATTCGGAATGTTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001270.1-3559s1c1
Sequence:CCGGGCGGTTTATCAAGAGCTATAACTCGAGTTATAGCTCTTGATAAACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001270.1-1782s1c1
Sequence:CCGGCCACTCTTACTTCCTGGCAAACTCGAGTTTGCCAGGAAGTAAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001270.1-4915s1c1
Sequence:CCGGCCATCGTGATTGGGATCACTACTCGAGTAGTGATCCCAATCACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001270.1-681s1c1
Sequence:CCGGGCAGTTGTGATGAAACAGAATCTCGAGATTCTGTTTCATCACAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001270
VALIDATED
CHD1 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001270.2-1313s21c1
Sequence:CCGGCAAATAGTGGAACGTATAATTCTCGAGAATTATACGTTCCACTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001270.2-5605s21c1
Sequence:CCGGTTTAGACTGACCTCCATTTAACTCGAGTTAAATGGAGGTCAGTCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001270.2-4802s21c1
Sequence:CCGGCAGTACCATGATCATCATAAACTCGAGTTTATGATGATCATGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001270.2-5329s21c1
Sequence:CCGGCATAAACCAACACAGTAATTGCTCGAGCAATTACTGTGTTGGTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001270.2-1450s21c1
Sequence:GTACCGGAGCATGCATTGATGAGTATTTCTCGAGAAATACTCATCAATGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001270.2-5411s21c1
Sequence:CCGGCCAGGATGCAAGGTCTATTATCTCGAGATAATAGACCTTGCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001270.2-5088s21c1
Sequence:CCGGCTGAATATACGCACCATAAATCTCGAGATTTATGGTGCGTATATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001270.2-4921s21c1
Sequence:CCGGCAAGCAAGACAGCAGATATTACTCGAGTAATATCTGCTGTCTTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001270.2-1987s21c1
Sequence:CCGGTGATGAAGCACACCGATTAAACTCGAGTTTAATCGGTGTGCTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001270.2-3741s21c1
Sequence:CCGGAGGGTCCAACATTCCGAATATCTCGAGATATTCGGAATGTTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001270.1-3559s1c1
Sequence:CCGGGCGGTTTATCAAGAGCTATAACTCGAGTTATAGCTCTTGATAAACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001270.1-1782s1c1
Sequence:CCGGCCACTCTTACTTCCTGGCAAACTCGAGTTTGCCAGGAAGTAAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001270.1-4915s1c1
Sequence:CCGGCCATCGTGATTGGGATCACTACTCGAGTAGTGATCCCAATCACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001270.1-681s1c1
Sequence:CCGGGCAGTTGTGATGAAACAGAATCTCGAGATTCTGTTTCATCACAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007690
VALIDATED
CHD1 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007690.3-1652s21c1
Sequence:CCGGCAGATAGTGGAGCGCATAATTCTCGAGAATTATGCGCTCCACTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007690.3-5759s21c1
Sequence:CCGGCCAGGACGCAAGGTCTATTATCTCGAGATAATAGACCTTGCGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007690.3-2326s21c1
Sequence:CCGGTGATGAAGCGCATCGATTAAACTCGAGTTTAATCGATGCGCTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007690.3-5435s21c1
Sequence:CCGGTCCGAGCACACACATCATAAACTCGAGTTTATGATGTGTGTGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007690.3-3871s21c1
Sequence:CCGGTGCGGAGATTCGGCGGTTTATCTCGAGATAAACCGCCGAATCTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007690.1-3558s1c1
Sequence:CCGGCGGCGGTTTATCAAGAGCTATCTCGAGATAGCTCTTGATAAACCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007690.1-3039s1c1
Sequence:CCGGCCCTTCAATAAAGAGGAGTTACTCGAGTAACTCCTCTTTATTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007690.1-1572s1c1
Sequence:CCGGCCATCCTATATTGGAGGACATCTCGAGATGTCCTCCAATATAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007690.1-1100s1c1
Sequence:CCGGGCCAGGAGACATACAGTATTTCTCGAGAAATACTGTATGTCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007690.1-4077s1c1
Sequence:CCGGCGTGCAGACTACCTCATCAAACTCGAGTTTGATGAGGTAGTCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007690
VALIDATED
CHD1 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007690.3-1652s21c1
Sequence:CCGGCAGATAGTGGAGCGCATAATTCTCGAGAATTATGCGCTCCACTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007690.3-5759s21c1
Sequence:CCGGCCAGGACGCAAGGTCTATTATCTCGAGATAATAGACCTTGCGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007690.3-2326s21c1
Sequence:CCGGTGATGAAGCGCATCGATTAAACTCGAGTTTAATCGATGCGCTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007690.3-5435s21c1
Sequence:CCGGTCCGAGCACACACATCATAAACTCGAGTTTATGATGTGTGTGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007690.3-3871s21c1
Sequence:CCGGTGCGGAGATTCGGCGGTTTATCTCGAGATAAACCGCCGAATCTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007690.1-3558s1c1
Sequence:CCGGCGGCGGTTTATCAAGAGCTATCTCGAGATAGCTCTTGATAAACCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007690.1-3039s1c1
Sequence:CCGGCCCTTCAATAAAGAGGAGTTACTCGAGTAACTCCTCTTTATTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007690.1-1572s1c1
Sequence:CCGGCCATCCTATATTGGAGGACATCTCGAGATGTCCTCCAATATAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007690.1-1100s1c1
Sequence:CCGGGCCAGGAGACATACAGTATTTCTCGAGAAATACTGTATGTCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007690.1-4077s1c1
Sequence:CCGGCGTGCAGACTACCTCATCAAACTCGAGTTTGATGAGGTAGTCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007690
VALIDATED
CHD1 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007690.3-1652s21c1
Sequence:CCGGCAGATAGTGGAGCGCATAATTCTCGAGAATTATGCGCTCCACTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007690.3-5759s21c1
Sequence:CCGGCCAGGACGCAAGGTCTATTATCTCGAGATAATAGACCTTGCGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007690.3-2326s21c1
Sequence:CCGGTGATGAAGCGCATCGATTAAACTCGAGTTTAATCGATGCGCTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007690.3-5435s21c1
Sequence:CCGGTCCGAGCACACACATCATAAACTCGAGTTTATGATGTGTGTGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007690.3-3871s21c1
Sequence:CCGGTGCGGAGATTCGGCGGTTTATCTCGAGATAAACCGCCGAATCTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007690.1-3558s1c1
Sequence:CCGGCGGCGGTTTATCAAGAGCTATCTCGAGATAGCTCTTGATAAACCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007690.1-3039s1c1
Sequence:CCGGCCCTTCAATAAAGAGGAGTTACTCGAGTAACTCCTCTTTATTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007690.1-1572s1c1
Sequence:CCGGCCATCCTATATTGGAGGACATCTCGAGATGTCCTCCAATATAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007690.1-1100s1c1
Sequence:CCGGGCCAGGAGACATACAGTATTTCTCGAGAAATACTGTATGTCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007690.1-4077s1c1
Sequence:CCGGCGTGCAGACTACCTCATCAAACTCGAGTTTGATGAGGTAGTCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks