EMAIL THIS PAGE TO A FRIEND

CHD1L

chromodomain helicase DNA binding protein 1-like

71 Gene Product Result for
Synonyms: ALC1 CHDL
Gene ID:
Human(9557) Summary: This gene encodes a DNA helicase protein involved in DNA repair. The protein converts ATP to add poly(ADP-ribose) as it regulates chromatin relaxation following DNA damage. Several alternatively spliced transcripts variants have been described for this gene. [provided by RefSeq, Jan 2012]
Mouse(68058) chromodomain helicase DNA binding protein 1-like
Rat(310707) chromodomain helicase DNA binding protein 1-like
domestic guinea pig(100717053) chromodomain helicase DNA binding protein 1-like
naked mole-rat(101723018) chromodomain helicase DNA binding protein 1-like
sheep(101113972) chromodomain helicase DNA binding protein 1-like
Zebrafish(393283) chromodomain helicase DNA binding protein 1-like
chicken(418338) chromodomain helicase DNA binding protein 1-like
domestic cat(101092781) chromodomain helicase DNA binding protein 1-like
cow(524787) chromodomain helicase DNA binding protein 1-like
dog(475820) chromodomain helicase DNA binding protein 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004284 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026539 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026539 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026539 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004284 Rosetta Predictions human pricing
NM_001107704 Rosetta Predictions rat pricing
NM_026539 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022691 predicted 478
2 SASI_Hs01_00022694 predicted 1189
3 SASI_Hs01_00022696 predicted 501
4 SASI_Hs02_00337273 predicted 2255
5 SASI_Hs01_00022697 predicted 1119
6 SASI_Hs01_00022698 predicted 2196
7 SASI_Hs01_00022699 predicted 942
8 SASI_Hs01_00022700 predicted 801
9 SASI_Hs02_00337274 predicted 2611
10 SASI_Hs02_00337275 predicted 1283
11 SASI_Hs01_00022692 predicted 484
12 SASI_Hs01_00022693 predicted 941
13 SASI_Hs01_00022695 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231455 predicted 2442
2 SASI_Rn02_00231456 predicted 2665
3 SASI_Rn02_00231457 predicted 2503
4 SASI_Rn02_00231458 predicted 1140
5 SASI_Rn02_00231459 predicted 1308
6 SASI_Rn02_00231460 predicted 1457
7 SASI_Rn02_00231461 predicted 2542
8 SASI_Rn02_00231462 predicted 2365
9 SASI_Rn02_00231463 predicted 1450
10 SASI_Rn02_00231464 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115080 predicted 1369
2 SASI_Mm01_00115081 predicted 1708
3 SASI_Mm01_00115082 predicted 468
4 SASI_Mm01_00115083 predicted 1475
5 SASI_Mm01_00115084 predicted 2637
6 SASI_Mm01_00115085 predicted 1123
7 SASI_Mm02_00330467 predicted 2529
8 SASI_Mm01_00115087 predicted 1528
9 SASI_Mm01_00115088 predicted 1210
10 SASI_Mm01_00115089 predicted 1748
11 SASI_Mm01_00115086 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004284
VALIDATED
CHD1L MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 1-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004284.2-2735s1c1
Sequence:CCGGCCTGTCTTTAGCAACCAGCTACTCGAGTAGCTGGTTGCTAAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004284.2-285s1c1
Sequence:CCGGGCAGGAAGATTAAATGATGAACTCGAGTTCATCATTTAATCTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004284.2-770s1c1
Sequence:CCGGGCACAAACTCTTGCAGCCATTCTCGAGAATGGCTGCAAGAGTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004284.2-1974s1c1
Sequence:CCGGGCCAAGAGAAGGAGACTCATACTCGAGTATGAGTCTCCTTCTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004284.3-2587s21c1
Sequence:CCGGCGTATTGGACATGCCACGAAACTCGAGTTTCGTGGCATGTCCAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004284.3-2017s21c1
Sequence:CCGGGCCAAGAGAAGGAGACTCATACTCGAGTATGAGTCTCCTTCTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004284.3-2778s21c1
Sequence:CCGGCCTGTCTTTAGCAACCAGCTACTCGAGTAGCTGGTTGCTAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004284.3-328s21c1
Sequence:CCGGGCAGGAAGATTAAATGATGAACTCGAGTTCATCATTTAATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004284
VALIDATED
CHD1L MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 1-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004284.2-2735s1c1
Sequence:CCGGCCTGTCTTTAGCAACCAGCTACTCGAGTAGCTGGTTGCTAAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004284.2-285s1c1
Sequence:CCGGGCAGGAAGATTAAATGATGAACTCGAGTTCATCATTTAATCTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004284.2-770s1c1
Sequence:CCGGGCACAAACTCTTGCAGCCATTCTCGAGAATGGCTGCAAGAGTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004284.2-1974s1c1
Sequence:CCGGGCCAAGAGAAGGAGACTCATACTCGAGTATGAGTCTCCTTCTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004284.3-2587s21c1
Sequence:CCGGCGTATTGGACATGCCACGAAACTCGAGTTTCGTGGCATGTCCAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004284.3-2017s21c1
Sequence:CCGGGCCAAGAGAAGGAGACTCATACTCGAGTATGAGTCTCCTTCTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004284.3-2778s21c1
Sequence:CCGGCCTGTCTTTAGCAACCAGCTACTCGAGTAGCTGGTTGCTAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004284.3-328s21c1
Sequence:CCGGGCAGGAAGATTAAATGATGAACTCGAGTTCATCATTTAATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004284
VALIDATED
CHD1L MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 1-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004284.2-2735s1c1
Sequence:CCGGCCTGTCTTTAGCAACCAGCTACTCGAGTAGCTGGTTGCTAAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004284.2-285s1c1
Sequence:CCGGGCAGGAAGATTAAATGATGAACTCGAGTTCATCATTTAATCTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004284.2-770s1c1
Sequence:CCGGGCACAAACTCTTGCAGCCATTCTCGAGAATGGCTGCAAGAGTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004284.2-1974s1c1
Sequence:CCGGGCCAAGAGAAGGAGACTCATACTCGAGTATGAGTCTCCTTCTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004284.3-2587s21c1
Sequence:CCGGCGTATTGGACATGCCACGAAACTCGAGTTTCGTGGCATGTCCAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004284.3-2017s21c1
Sequence:CCGGGCCAAGAGAAGGAGACTCATACTCGAGTATGAGTCTCCTTCTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004284.3-2778s21c1
Sequence:CCGGCCTGTCTTTAGCAACCAGCTACTCGAGTAGCTGGTTGCTAAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004284.3-328s21c1
Sequence:CCGGGCAGGAAGATTAAATGATGAACTCGAGTTCATCATTTAATCTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026539
VALIDATED
CHD1L MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 1-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026539.1-2640s1c1
Sequence:CCGGCCCAACTTACATATACTACTTCTCGAGAAGTAGTATATGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026539.1-1464s1c1
Sequence:CCGGGCAGCTTACCAACATGGTCATCTCGAGATGACCATGTTGGTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026539.1-680s1c1
Sequence:CCGGGCAGAGAACAGGTGGAAGATTCTCGAGAATCTTCCACCTGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026539.1-2804s1c1
Sequence:CCGGCAAGGCTATCTTTGGTCATATCTCGAGATATGACCAAAGATAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026539.1-2637s1c1
Sequence:CCGGCATCCCAACTTACATATACTACTCGAGTAGTATATGTAAGTTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026539.2-2638s21c1
Sequence:CCGGCCCAACTTACATATACTACTTCTCGAGAAGTAGTATATGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026539.2-678s21c1
Sequence:CCGGGCAGAGAACAGGTGGAAGATTCTCGAGAATCTTCCACCTGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026539.2-2544s21c1
Sequence:CCGGGCGTTCATCTTCCACGAATTGCTCGAGCAATTCGTGGAAGATGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026539.2-2748s21c1
Sequence:CCGGTTTCAGCAACCAGTTAGATTCCTCGAGGAATCTAACTGGTTGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026539.2-447s21c1
Sequence:CCGGTGCTGACGACATACGAGATTTCTCGAGAAATCTCGTATGTCGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026539
VALIDATED
CHD1L MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 1-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026539.1-2640s1c1
Sequence:CCGGCCCAACTTACATATACTACTTCTCGAGAAGTAGTATATGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026539.1-1464s1c1
Sequence:CCGGGCAGCTTACCAACATGGTCATCTCGAGATGACCATGTTGGTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026539.1-680s1c1
Sequence:CCGGGCAGAGAACAGGTGGAAGATTCTCGAGAATCTTCCACCTGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026539.1-2804s1c1
Sequence:CCGGCAAGGCTATCTTTGGTCATATCTCGAGATATGACCAAAGATAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026539.1-2637s1c1
Sequence:CCGGCATCCCAACTTACATATACTACTCGAGTAGTATATGTAAGTTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026539.2-2638s21c1
Sequence:CCGGCCCAACTTACATATACTACTTCTCGAGAAGTAGTATATGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026539.2-678s21c1
Sequence:CCGGGCAGAGAACAGGTGGAAGATTCTCGAGAATCTTCCACCTGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026539.2-2544s21c1
Sequence:CCGGGCGTTCATCTTCCACGAATTGCTCGAGCAATTCGTGGAAGATGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026539.2-2748s21c1
Sequence:CCGGTTTCAGCAACCAGTTAGATTCCTCGAGGAATCTAACTGGTTGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026539.2-447s21c1
Sequence:CCGGTGCTGACGACATACGAGATTTCTCGAGAAATCTCGTATGTCGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026539
VALIDATED
CHD1L MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 1-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026539.1-2640s1c1
Sequence:CCGGCCCAACTTACATATACTACTTCTCGAGAAGTAGTATATGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026539.1-1464s1c1
Sequence:CCGGGCAGCTTACCAACATGGTCATCTCGAGATGACCATGTTGGTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026539.1-680s1c1
Sequence:CCGGGCAGAGAACAGGTGGAAGATTCTCGAGAATCTTCCACCTGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026539.1-2804s1c1
Sequence:CCGGCAAGGCTATCTTTGGTCATATCTCGAGATATGACCAAAGATAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026539.1-2637s1c1
Sequence:CCGGCATCCCAACTTACATATACTACTCGAGTAGTATATGTAAGTTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026539.2-2638s21c1
Sequence:CCGGCCCAACTTACATATACTACTTCTCGAGAAGTAGTATATGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026539.2-678s21c1
Sequence:CCGGGCAGAGAACAGGTGGAAGATTCTCGAGAATCTTCCACCTGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026539.2-2544s21c1
Sequence:CCGGGCGTTCATCTTCCACGAATTGCTCGAGCAATTCGTGGAAGATGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026539.2-2748s21c1
Sequence:CCGGTTTCAGCAACCAGTTAGATTCCTCGAGGAATCTAACTGGTTGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026539.2-447s21c1
Sequence:CCGGTGCTGACGACATACGAGATTTCTCGAGAAATCTCGTATGTCGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks