EMAIL THIS PAGE TO A FRIEND

CHD2

chromodomain helicase DNA binding protein 2

116 Gene Product Result for
Synonyms: EEOC
UniProtKB ID: O14647, C6G482, Q96IP5
Gene ID:
Human(1106) Summary: The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(244059) chromodomain helicase DNA binding protein 2
Rat(308738) chromodomain helicase DNA binding protein 2
Zebrafish(569795) chromodomain helicase DNA binding protein 2
cow(535026) chromodomain helicase DNA binding protein 2
Horse(100049803) chromodomain helicase DNA binding protein 2
domestic cat(101094509) chromodomain helicase DNA binding protein 2
dog(479028) chromodomain helicase DNA binding protein 2
chicken(770804) chromodomain helicase DNA binding protein 2
chicken(415507) chromodomain helicase DNA binding protein 2
sheep(101119938) chromodomain helicase DNA binding protein 2
naked mole-rat(101717324) chromodomain helicase DNA binding protein 2
domestic guinea pig(101788363) chromodomain helicase DNA binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081345 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081345 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081345 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001271 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042572 Rosetta Predictions human pricing
NM_001271 Rosetta Predictions human pricing
NM_001107523 Rosetta Predictions rat pricing
NM_001081345 Rosetta Predictions mouse pricing
XM_001478970 Rosetta Predictions mouse pricing
XM_897304 Rosetta Predictions mouse pricing
XM_897315 Rosetta Predictions mouse pricing
XM_977302 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310588 predicted 832
2 SASI_Hs02_00310589 predicted 1803
3 SASI_Hs02_00310590 predicted 1794
4 SASI_Hs02_00310591 predicted 1789
5 SASI_Hs02_00310592 predicted 716
6 SASI_Hs02_00310593 predicted 679
7 SASI_Hs02_00310594 predicted 830
8 SASI_Hs02_00310595 predicted 771
9 SASI_Hs02_00310596 predicted 759
10 SASI_Hs02_00310597 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331475 predicted 1699
2 SASI_Hs02_00331476 predicted 1800
3 SASI_Hs01_00047840 predicted 1792
4 SASI_Hs02_00331477 predicted 1794
5 SASI_Hs01_00047841 predicted 1740
6 SASI_Hs02_00331478 predicted 1613
7 SASI_Hs02_00331479 predicted 1535
8 SASI_Hs01_00047842 predicted 1603
9 SASI_Hs02_00331480 predicted 1701
10 SASI_Hs02_00331481 predicted 829
11 SASI_Hs01_00047838 predicted 3420
12 SASI_Hs01_00047839 predicted 3731
13 SASI_Hs01_00047843 predicted 5708
14 SASI_Hs01_00047844 predicted 3920
15 SASI_Hs01_00047845 predicted 2485
16 SASI_Hs01_00047846 predicted 3472
17 SASI_Hs01_00047847 predicted 6004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229665 predicted 5608
2 SASI_Rn02_00229666 predicted 927
3 SASI_Rn02_00229667 predicted 5222
4 SASI_Rn02_00229668 predicted 5527
5 SASI_Rn02_00229669 predicted 1437
6 SASI_Rn02_00229670 predicted 5580
7 SASI_Rn02_00229671 predicted 896
8 SASI_Rn02_00229672 predicted 3990
9 SASI_Rn02_00229673 predicted 2262
10 SASI_Rn02_00229674 predicted 2359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081345 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297501 predicted 895
2 SASI_Mm02_00297502 predicted 3693
3 SASI_Mm02_00297503 predicted 925
4 SASI_Mm02_00297504 predicted 1942
5 SASI_Mm02_00297505 predicted 2240
6 SASI_Mm02_00297506 predicted 2949
7 SASI_Mm02_00297507 predicted 1415
8 SASI_Mm02_00297508 predicted 3810
9 SASI_Mm02_00297509 predicted 1283
10 SASI_Mm02_00297510 predicted 3902
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478970 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00406694 predicted 974
2 SASI_Mm02_00406695 predicted 3784
3 SASI_Mm02_00406696 predicted 1013
4 SASI_Mm02_00406697 predicted 2024
5 SASI_Mm02_00406698 predicted 2325
6 SASI_Mm02_00406699 predicted 3031
7 SASI_Mm02_00406700 predicted 1496
8 SASI_Mm02_00406701 predicted 3893
9 SASI_Mm02_00406702 predicted 1367
10 SASI_Mm02_00406703 predicted 3982
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254757 predicted 580
2 SASI_Mm01_00254758 predicted 3384
3 SASI_Mm01_00254759 predicted 612
4 SASI_Mm01_00254760 predicted 1626
5 SASI_Mm01_00254761 predicted 1924
6 SASI_Mm01_00254762 predicted 2639
7 SASI_Mm01_00254763 predicted 1094
8 SASI_Mm01_00254764 predicted 3498
9 SASI_Mm01_00254765 predicted 966
10 SASI_Mm01_00254766 predicted 3585
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253280 predicted 479
2 SASI_Mm01_00253281 predicted 473
3 SASI_Mm01_00253282 predicted 537
4 SASI_Mm01_00253283 predicted 504
5 SASI_Mm01_00253284 predicted 473
6 SASI_Mm01_00253285 predicted 489
7 SASI_Mm01_00253286 predicted 522
8 SASI_Mm01_00253287 predicted 500
9 SASI_Mm01_00253288 predicted 293
10 SASI_Mm01_00253289 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00446256 predicted 972
2 SASI_Mm02_00446257 predicted 3778
3 SASI_Mm02_00446258 predicted 1009
4 SASI_Mm02_00446259 predicted 2025
5 SASI_Mm02_00446260 predicted 2318
6 SASI_Mm02_00446261 predicted 3033
7 SASI_Mm02_00446262 predicted 1498
8 SASI_Mm02_00446263 predicted 3890
9 SASI_Mm02_00446264 predicted 1370
10 SASI_Mm02_00446265 predicted 3983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081345
VALIDATED
CHD2 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081345.2-921s21c1
Sequence:CCGGCAAGAACCATCACGATTTAATCTCGAGATTAAATCGTGATGGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081345.2-7581s21c1
Sequence:GTACCGGTCATCCAGGCAGTACTATTAACTCGAGTTAATAGTACTGCCTGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081345.2-4461s21c1
Sequence:CCGGCTACCAGTGGAGACGGATAAACTCGAGTTTATCCGTCTCCACTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081345.2-2380s21c1
Sequence:CCGGAGACCGTGCTGGGCAGTATTACTCGAGTAATACTGCCCAGCACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081345.2-3786s21c1
Sequence:CCGGCGGATTCGCAGTTCCACTAAACTCGAGTTTAGTGGAACTGCGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081345
VALIDATED
CHD2 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081345.2-921s21c1
Sequence:CCGGCAAGAACCATCACGATTTAATCTCGAGATTAAATCGTGATGGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081345.2-7581s21c1
Sequence:GTACCGGTCATCCAGGCAGTACTATTAACTCGAGTTAATAGTACTGCCTGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081345.2-4461s21c1
Sequence:CCGGCTACCAGTGGAGACGGATAAACTCGAGTTTATCCGTCTCCACTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081345.2-2380s21c1
Sequence:CCGGAGACCGTGCTGGGCAGTATTACTCGAGTAATACTGCCCAGCACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081345.2-3786s21c1
Sequence:CCGGCGGATTCGCAGTTCCACTAAACTCGAGTTTAGTGGAACTGCGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081345
VALIDATED
CHD2 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081345.2-921s21c1
Sequence:CCGGCAAGAACCATCACGATTTAATCTCGAGATTAAATCGTGATGGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081345.2-7581s21c1
Sequence:GTACCGGTCATCCAGGCAGTACTATTAACTCGAGTTAATAGTACTGCCTGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081345.2-4461s21c1
Sequence:CCGGCTACCAGTGGAGACGGATAAACTCGAGTTTATCCGTCTCCACTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081345.2-2380s21c1
Sequence:CCGGAGACCGTGCTGGGCAGTATTACTCGAGTAATACTGCCCAGCACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081345.2-3786s21c1
Sequence:CCGGCGGATTCGCAGTTCCACTAAACTCGAGTTTAGTGGAACTGCGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001271
VALIDATED
CHD2 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001271.3-4210s21c1
Sequence:CCGGTATCCGGAGTTCAGGTTAATGCTCGAGCATTAACCTGAACTCCGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001271.3-8058s21c1
Sequence:CCGGTGGAGCTTCTTGCCGATAATACTCGAGTATTATCGGCAAGAAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001271.3-924s21c1
Sequence:CCGGCAAGAACCATCGCGATTTAATCTCGAGATTAAATCGCGATGGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001271.3-3987s21c1
Sequence:CCGGAGGTTCATCAAGGCTTATAAGCTCGAGCTTATAAGCCTTGATGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001271.1-1926s1c1
Sequence:CCGGCCCTCAAATGAGCCCGAATATCTCGAGATATTCGGGCTCATTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001271.1-3173s1c1
Sequence:CCGGCCTGGCTGAATACCTAACTATCTCGAGATAGTTAGGTATTCAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001271.1-966s1c1
Sequence:CCGGGCCTCTAAGAAGGAACGGATACTCGAGTATCCGTTCCTTCTTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001271.1-2430s1c1
Sequence:CCGGCGGGAATATGAATGGATTCATCTCGAGATGAATCCATTCATATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001271.1-4115s1c1
Sequence:CCGGCCGAAGGTTCATCAAGGCTTACTCGAGTAAGCCTTGATGAACCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001271
VALIDATED
CHD2 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001271.3-4210s21c1
Sequence:CCGGTATCCGGAGTTCAGGTTAATGCTCGAGCATTAACCTGAACTCCGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001271.3-8058s21c1
Sequence:CCGGTGGAGCTTCTTGCCGATAATACTCGAGTATTATCGGCAAGAAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001271.3-924s21c1
Sequence:CCGGCAAGAACCATCGCGATTTAATCTCGAGATTAAATCGCGATGGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001271.3-3987s21c1
Sequence:CCGGAGGTTCATCAAGGCTTATAAGCTCGAGCTTATAAGCCTTGATGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001271.1-1926s1c1
Sequence:CCGGCCCTCAAATGAGCCCGAATATCTCGAGATATTCGGGCTCATTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001271.1-3173s1c1
Sequence:CCGGCCTGGCTGAATACCTAACTATCTCGAGATAGTTAGGTATTCAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001271.1-966s1c1
Sequence:CCGGGCCTCTAAGAAGGAACGGATACTCGAGTATCCGTTCCTTCTTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001271.1-2430s1c1
Sequence:CCGGCGGGAATATGAATGGATTCATCTCGAGATGAATCCATTCATATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001271.1-4115s1c1
Sequence:CCGGCCGAAGGTTCATCAAGGCTTACTCGAGTAAGCCTTGATGAACCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001271
VALIDATED
CHD2 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001271.3-4210s21c1
Sequence:CCGGTATCCGGAGTTCAGGTTAATGCTCGAGCATTAACCTGAACTCCGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001271.3-8058s21c1
Sequence:CCGGTGGAGCTTCTTGCCGATAATACTCGAGTATTATCGGCAAGAAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001271.3-924s21c1
Sequence:CCGGCAAGAACCATCGCGATTTAATCTCGAGATTAAATCGCGATGGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001271.3-3987s21c1
Sequence:CCGGAGGTTCATCAAGGCTTATAAGCTCGAGCTTATAAGCCTTGATGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001271.1-1926s1c1
Sequence:CCGGCCCTCAAATGAGCCCGAATATCTCGAGATATTCGGGCTCATTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001271.1-3173s1c1
Sequence:CCGGCCTGGCTGAATACCTAACTATCTCGAGATAGTTAGGTATTCAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001271.1-966s1c1
Sequence:CCGGGCCTCTAAGAAGGAACGGATACTCGAGTATCCGTTCCTTCTTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001271.1-2430s1c1
Sequence:CCGGCGGGAATATGAATGGATTCATCTCGAGATGAATCCATTCATATTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001271.1-4115s1c1
Sequence:CCGGCCGAAGGTTCATCAAGGCTTACTCGAGTAAGCCTTGATGAACCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks