EMAIL THIS PAGE TO A FRIEND

CHD3

chromodomain helicase DNA binding protein 3

156 Gene Product Result for
Synonyms: Mi-2a Mi2-ALPHA ZFH
UniProtKB ID: Q12873, D3DTQ9, E9PG89, Q9Y4I0
Gene ID:
Human(1107) Summary: This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(216848) chromodomain helicase DNA binding protein 3
Rat(303241) chromodomain helicase DNA binding protein 3
domestic guinea pig(100732819) chromodomain helicase DNA binding protein 3
naked mole-rat(101704396) chromodomain helicase DNA binding protein 3
sheep(101119918) chromodomain helicase DNA binding protein 3
Domestic Rabbit(100342829) chromodomain helicase DNA binding protein 3
Zebrafish(568230) chromodomain helicase DNA binding protein 3
domestic cat(101100517) chromodomain helicase DNA binding protein 3
cow(532673) chromodomain helicase DNA binding protein 3
dog(479489) chromodomain helicase DNA binding protein 3
fruit fly(40111) CG9594 gene product from transcript CG9594-RA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005271 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_484041 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484041 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484041 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_146019 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146019 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146019 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122631 MISSION® esiRNA esiRNA human CHD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005271 Rosetta Predictions human pricing
NM_001005273 Rosetta Predictions human pricing
NM_005852 Rosetta Predictions human pricing
XM_001079343 Rosetta Predictions rat pricing
XM_220602 Rosetta Predictions rat pricing
NM_146019 Rosetta Predictions mouse pricing
XM_484041 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049705 predicted 5476
2 SASI_Hs01_00049706 predicted 4071
3 SASI_Hs01_00049707 predicted 1897
4 SASI_Hs01_00049708 predicted 4833
5 SASI_Hs01_00049709 predicted 3724
6 SASI_Hs01_00049710 predicted 3158
7 SASI_Hs01_00049711 predicted 2754
8 SASI_Hs01_00049712 predicted 3460
9 SASI_Hs01_00049713 predicted 3070
10 SASI_Hs02_00304814 predicted 4647
11 SASI_Hs01_00049704 predicted 3066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167837 predicted 5446
2 SASI_Hs02_00304815 predicted 4045
3 SASI_Hs01_00167838 predicted 1867
4 SASI_Hs02_00304816 predicted 4802
5 SASI_Hs01_00167840 predicted 3694
6 SASI_Hs01_00167841 predicted 3137
7 SASI_Hs01_00167842 predicted 2722
8 SASI_Hs01_00167843 predicted 3436
9 SASI_Hs01_00167844 predicted 3042
10 SASI_Hs01_00167845 predicted 4619
11 SASI_Hs01_00167836 predicted 3100
12 SASI_Hs01_00167839 predicted 4720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034976 predicted 5344
2 SASI_Hs01_00034977 predicted 4044
3 SASI_Hs01_00034978 predicted 1867
4 SASI_Hs01_00034979 predicted 4804
5 SASI_Hs01_00034980 predicted 3697
6 SASI_Hs01_00034981 predicted 3132
7 SASI_Hs01_00034982 predicted 2728
8 SASI_Hs01_00034983 predicted 3431
9 SASI_Hs01_00034984 predicted 3044
10 SASI_Hs02_00340401 predicted 4618
11 SASI_Hs01_00034975 predicted 3090
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364068 predicted 2914
2 SASI_Rn02_00364069 predicted 4077
3 SASI_Rn02_00364070 predicted 3036
4 SASI_Rn02_00364071 predicted 2623
5 SASI_Rn02_00364072 predicted 1934
6 SASI_Rn02_00364073 predicted 2827
7 SASI_Rn02_00364074 predicted 4002
8 SASI_Rn02_00364075 predicted 2258
9 SASI_Rn02_00364076 predicted 3793
10 SASI_Rn02_00364077 predicted 2637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379416 predicted 3230
2 SASI_Rn02_00379417 predicted 4390
3 SASI_Rn02_00379418 predicted 3351
4 SASI_Rn02_00379419 predicted 2941
5 SASI_Rn02_00379420 predicted 2248
6 SASI_Rn02_00379421 predicted 3134
7 SASI_Rn02_00379422 predicted 4311
8 SASI_Rn02_00379423 predicted 2567
9 SASI_Rn02_00379424 predicted 4105
10 SASI_Rn02_00379425 predicted 2951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341582 predicted 3294
2 SASI_Mm02_00341583 predicted 2885
3 SASI_Mm02_00341584 predicted 3170
4 SASI_Mm02_00341585 predicted 2332
5 SASI_Mm02_00341586 predicted 5699
6 SASI_Mm02_00341587 predicted 4331
7 SASI_Mm02_00341588 predicted 3478
8 SASI_Mm02_00341589 predicted 5199
9 SASI_Mm02_00341590 predicted 4837
10 SASI_Mm02_00341591 predicted 2089
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484041 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256800 predicted 6207
2 SASI_Mm01_00256801 predicted 6207
3 SASI_Mm01_00256802 predicted 6205
4 SASI_Mm01_00256803 predicted 6220
5 SASI_Mm01_00256804 predicted 6256
6 SASI_Mm01_00256805 predicted 6202
7 SASI_Mm01_00256806 predicted 6376
8 SASI_Mm01_00256807 predicted 6398
9 SASI_Mm01_00256808 predicted 6223
10 SASI_Mm01_00256809 predicted 6427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005271
VALIDATED
CHD3 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005271.1-5486s1c1
Sequence:CCGGGCCATTATCAACGAGCCATTTCTCGAGAAATGGCTCGTTGATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005271.1-6453s1c1
Sequence:CCGGCCTCCCACACTGCCAAGTATACTCGAGTATACTTGGCAGTGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005271.1-2604s1c1
Sequence:CCGGCCAAATTCTATGTGGTGACATCTCGAGATGTCACCACATAGAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005271.1-1897s1c1
Sequence:CCGGCCATTTGGTTATGTATCGAAACTCGAGTTTCGATACATAACCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005271.1-4208s1c1
Sequence:CCGGCGCAAGCAAGTTAACTACAATCTCGAGATTGTAGTTAACTTGCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005271.2-2114s21c1
Sequence:GTACCGGGAATTACCACTATCTAGTAAACTCGAGTTTACTAGATAGTGGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005271.2-2345s21c1
Sequence:GTACCGGTGAGACTCAGCCACGGTTTATCTCGAGATAAACCGTGGCTGAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005271.2-1703s21c1
Sequence:GTACCGGAGTGCAGAAGATCCTACATTGCTCGAGCAATGTAGGATCTTCTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005271.2-6631s21c1
Sequence:GTACCGGGGACTTTAGAGAGGGATGAAACTCGAGTTTCATCCCTCTCTAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005271.2-6553s21c1
Sequence:GTACCGGCTCATGTGGAAGTGGAGAATCCTCGAGGATTCTCCACTTCCACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005271.2-4701s21c1
Sequence:GTACCGGATCAATGGGCGTTGGTCAATGCTCGAGCATTGACCAACGCCCATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005271.2-3528s21c1
Sequence:GTACCGGGAGGCCATCGATCGGTTTAATCTCGAGATTAAACCGATCGATGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005271
VALIDATED
CHD3 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005271.1-5486s1c1
Sequence:CCGGGCCATTATCAACGAGCCATTTCTCGAGAAATGGCTCGTTGATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005271.1-6453s1c1
Sequence:CCGGCCTCCCACACTGCCAAGTATACTCGAGTATACTTGGCAGTGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005271.1-2604s1c1
Sequence:CCGGCCAAATTCTATGTGGTGACATCTCGAGATGTCACCACATAGAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005271.1-1897s1c1
Sequence:CCGGCCATTTGGTTATGTATCGAAACTCGAGTTTCGATACATAACCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005271.1-4208s1c1
Sequence:CCGGCGCAAGCAAGTTAACTACAATCTCGAGATTGTAGTTAACTTGCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005271.2-2114s21c1
Sequence:GTACCGGGAATTACCACTATCTAGTAAACTCGAGTTTACTAGATAGTGGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005271.2-2345s21c1
Sequence:GTACCGGTGAGACTCAGCCACGGTTTATCTCGAGATAAACCGTGGCTGAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005271.2-1703s21c1
Sequence:GTACCGGAGTGCAGAAGATCCTACATTGCTCGAGCAATGTAGGATCTTCTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005271.2-6631s21c1
Sequence:GTACCGGGGACTTTAGAGAGGGATGAAACTCGAGTTTCATCCCTCTCTAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005271.2-6553s21c1
Sequence:GTACCGGCTCATGTGGAAGTGGAGAATCCTCGAGGATTCTCCACTTCCACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005271.2-4701s21c1
Sequence:GTACCGGATCAATGGGCGTTGGTCAATGCTCGAGCATTGACCAACGCCCATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005271.2-3528s21c1
Sequence:GTACCGGGAGGCCATCGATCGGTTTAATCTCGAGATTAAACCGATCGATGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005271
VALIDATED
CHD3 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005271.1-5486s1c1
Sequence:CCGGGCCATTATCAACGAGCCATTTCTCGAGAAATGGCTCGTTGATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005271.1-6453s1c1
Sequence:CCGGCCTCCCACACTGCCAAGTATACTCGAGTATACTTGGCAGTGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005271.1-2604s1c1
Sequence:CCGGCCAAATTCTATGTGGTGACATCTCGAGATGTCACCACATAGAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005271.1-1897s1c1
Sequence:CCGGCCATTTGGTTATGTATCGAAACTCGAGTTTCGATACATAACCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005271.1-4208s1c1
Sequence:CCGGCGCAAGCAAGTTAACTACAATCTCGAGATTGTAGTTAACTTGCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005271.2-2114s21c1
Sequence:GTACCGGGAATTACCACTATCTAGTAAACTCGAGTTTACTAGATAGTGGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005271.2-2345s21c1
Sequence:GTACCGGTGAGACTCAGCCACGGTTTATCTCGAGATAAACCGTGGCTGAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005271.2-1703s21c1
Sequence:GTACCGGAGTGCAGAAGATCCTACATTGCTCGAGCAATGTAGGATCTTCTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005271.2-6631s21c1
Sequence:GTACCGGGGACTTTAGAGAGGGATGAAACTCGAGTTTCATCCCTCTCTAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005271.2-6553s21c1
Sequence:GTACCGGCTCATGTGGAAGTGGAGAATCCTCGAGGATTCTCCACTTCCACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005271.2-4701s21c1
Sequence:GTACCGGATCAATGGGCGTTGGTCAATGCTCGAGCATTGACCAACGCCCATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005271.2-3528s21c1
Sequence:GTACCGGGAGGCCATCGATCGGTTTAATCTCGAGATTAAACCGATCGATGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484041
CHD3 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 3
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000186741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_484041.1-252s1c1
Sequence:CCGGGCCACCAGATAAAGATGATATCTCGAGATATCATCTTTATCTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_484041.1-2061s1c1
Sequence:CCGGCCGCATCATTAACCATAGTATCTCGAGATACTATGGTTAATGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_484041.1-3681s1c1
Sequence:CCGGCCAGGCCAACAAAGTGATGATCTCGAGATCATCACTTTGTTGGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484041
CHD3 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 3
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000186741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_484041.1-252s1c1
Sequence:CCGGGCCACCAGATAAAGATGATATCTCGAGATATCATCTTTATCTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_484041.1-2061s1c1
Sequence:CCGGCCGCATCATTAACCATAGTATCTCGAGATACTATGGTTAATGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_484041.1-3681s1c1
Sequence:CCGGCCAGGCCAACAAAGTGATGATCTCGAGATCATCACTTTGTTGGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484041
CHD3 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 3
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000186741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_484041.1-252s1c1
Sequence:CCGGGCCACCAGATAAAGATGATATCTCGAGATATCATCTTTATCTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_484041.1-2061s1c1
Sequence:CCGGCCGCATCATTAACCATAGTATCTCGAGATACTATGGTTAATGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_484041.1-3681s1c1
Sequence:CCGGCCAGGCCAACAAAGTGATGATCTCGAGATCATCACTTTGTTGGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146019
VALIDATED
CHD3 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146019.2-2233s21c1
Sequence:CCGGGGAGACACCGTGAGCTAATTACTCGAGTAATTAGCTCACGGTGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146019.2-2891s21c1
Sequence:CCGGTGGCTACAAGATAGATCATAACTCGAGTTATGATCTATCTTGTAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146019.2-6906s21c1
Sequence:CCGGGGCCTGGATACAGACTAAATTCTCGAGAATTTAGTCTGTATCCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146019.2-3476s21c1
Sequence:CCGGCCTAGACTATGAAGGCTATAACTCGAGTTATAGCCTTCATAGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146019.2-3182s21c1
Sequence:CCGGGTACATCCTAACTCGAAATTTCTCGAGAAATTTCGAGTTAGGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146019
VALIDATED
CHD3 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146019.2-2233s21c1
Sequence:CCGGGGAGACACCGTGAGCTAATTACTCGAGTAATTAGCTCACGGTGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146019.2-2891s21c1
Sequence:CCGGTGGCTACAAGATAGATCATAACTCGAGTTATGATCTATCTTGTAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146019.2-6906s21c1
Sequence:CCGGGGCCTGGATACAGACTAAATTCTCGAGAATTTAGTCTGTATCCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146019.2-3476s21c1
Sequence:CCGGCCTAGACTATGAAGGCTATAACTCGAGTTATAGCCTTCATAGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146019.2-3182s21c1
Sequence:CCGGGTACATCCTAACTCGAAATTTCTCGAGAAATTTCGAGTTAGGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146019
VALIDATED
CHD3 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146019.2-2233s21c1
Sequence:CCGGGGAGACACCGTGAGCTAATTACTCGAGTAATTAGCTCACGGTGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146019.2-2891s21c1
Sequence:CCGGTGGCTACAAGATAGATCATAACTCGAGTTATGATCTATCTTGTAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146019.2-6906s21c1
Sequence:CCGGGGCCTGGATACAGACTAAATTCTCGAGAATTTAGTCTGTATCCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146019.2-3476s21c1
Sequence:CCGGCCTAGACTATGAAGGCTATAACTCGAGTTATAGCCTTCATAGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146019.2-3182s21c1
Sequence:CCGGGTACATCCTAACTCGAAATTTCTCGAGAAATTTCGAGTTAGGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks