EMAIL THIS PAGE TO A FRIEND

CHD4

chromodomain helicase DNA binding protein 4

143 Gene Product Result for
Synonyms: Mi-2b Mi2-BETA
UniProtKB ID: Q14839, Q8IXZ5
Gene ID:
Human(1108) Summary: The product of this gene belongs to the SNF2/RAD54 helicase family. It represents the main component of the nucleosome remodeling and deacetylase complex and plays an important role in epigenetic transcriptional repression. Patients with dermatomyositis develop antibodies against this protein. [provided by RefSeq, Jul 2008]
Mouse(107932) chromodomain helicase DNA binding protein 4
Rat(117535) chromodomain helicase DNA binding protein 4
chicken(418278) chromodomain helicase DNA binding protein 4
cow(506402) chromodomain helicase DNA binding protein 4
Horse(100059817) chromodomain helicase DNA binding protein 4
domestic cat(101081904) chromodomain helicase DNA binding protein 4
dog(477714) chromodomain helicase DNA binding protein 4
sheep(101109874) chromodomain helicase DNA binding protein 4
Domestic Rabbit(100337729) chromodomain helicase DNA binding protein 4
naked mole-rat(101707353) chromodomain helicase DNA binding protein 4
domestic guinea pig(100735611) chromodomain helicase DNA binding protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA012008 Anti-CHD4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4500202 Anti-CHD4 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB2103845 Anti-CHD4, (N-terminal) antibody produced in rabbit affinity isolated antibody , rabbit, mouse, rat, human, horse, zebrafish, guinea pig, canine, bovine
western blot pricing
WH0001108M1 Monoclonal Anti-CHD4 antibody produced in mouse clone 4H4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403667 Monoclonal Anti-CHD4 antibody produced in mouse clone 4H4, ascites fluid human
ELISA, western blot pricing
SAB4200107 Monoclonal Anti-CHD4 antibody produced in mouse ~1.0 mg/mL, clone 3F2/4, purified immunoglobulin human, mouse
immunoprecipitation, western blot pricing
PLA0165 Rabbit anti-CHD4/Mi2 beta Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. bovine, guinea pig, rhesus monkey, horse, rat, mouse, rabbit, dog, gorilla, human, pig, primate
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001273 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001273 Rosetta Predictions human pricing
XM_001063352 Rosetta Predictions rat pricing
XM_001067862 Rosetta Predictions rat pricing
XM_232354 Rosetta Predictions rat pricing
NM_145979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243492 predicted 3790
2 SASI_Hs01_00243493 predicted 3682
3 SASI_Hs01_00243494 predicted 2458
4 SASI_Hs01_00243495 predicted 1955
5 SASI_Hs01_00243496 predicted 4135
6 SASI_Hs01_00243497 predicted 2157
7 SASI_Hs02_00331482 predicted 3809
8 SASI_Hs01_00243498 predicted 2804
9 SASI_Hs01_00243499 predicted 4636
10 SASI_Hs01_00243500 predicted 5439
11 SASI_Hs01_00243501 predicted 2834
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306791 predicted 215
2 SASI_Rn02_00306792 predicted 4142
3 SASI_Rn02_00306793 predicted 5754
4 SASI_Rn02_00306794 predicted 4644
5 SASI_Rn02_00306795 predicted 2350
6 SASI_Rn02_00306796 predicted 2101
7 SASI_Rn02_00306797 predicted 4338
8 SASI_Rn02_00306798 predicted 1435
9 SASI_Rn02_00306799 predicted 3511
10 SASI_Rn02_00306800 predicted 2808
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322601 predicted 2375
2 SASI_Rn02_00322602 predicted 3800
3 SASI_Rn02_00322603 predicted 5413
4 SASI_Rn02_00322604 predicted 4309
5 SASI_Rn02_00322605 predicted 2004
6 SASI_Rn02_00322606 predicted 1755
7 SASI_Rn02_00322607 predicted 3998
8 SASI_Rn02_00322608 predicted 1097
9 SASI_Rn02_00322609 predicted 3169
10 SASI_Rn02_00322610 predicted 2462
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387110 predicted 405
2 SASI_Rn02_00387111 predicted 4305
3 SASI_Rn02_00387112 predicted 5929
4 SASI_Rn02_00387113 predicted 4815
5 SASI_Rn02_00387114 predicted 2519
6 SASI_Rn02_00387115 predicted 2268
7 SASI_Rn02_00387116 predicted 4514
8 SASI_Rn02_00387117 predicted 1603
9 SASI_Rn02_00387118 predicted 3681
10 SASI_Rn02_00387119 predicted 2974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198858 predicted 2795
2 SASI_Mm01_00198859 predicted 2706
3 SASI_Mm01_00198860 predicted 3286
4 SASI_Mm01_00198861 predicted 2331
5 SASI_Mm01_00198862 predicted 2668
6 SASI_Mm01_00198863 predicted 4125
7 SASI_Mm01_00198864 predicted 1952
8 SASI_Mm01_00198865 predicted 4332
9 SASI_Mm01_00198867 predicted 1182
10 SASI_Mm02_00341480 predicted 3005
11 SASI_Mm01_00198866 predicted 4681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001273
VALIDATED
CHD4 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001273.2-6007s21c1
Sequence:GTACCGGGCCCATCTTCCATGTTGTAAACTCGAGTTTACAACATGGAAGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001273.2-4640s21c1
Sequence:CCGGCCTTACTAGAATTGGTGTTATCTCGAGATAACACCAATTCTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001273.2-2705s21c1
Sequence:CCGGGCTGCTGACATCCTATGAATTCTCGAGAATTCATAGGATGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001273.2-791s21c1
Sequence:CCGGGCGGGAGTTCAGTACCAATAACTCGAGTTATTGGTACTGAACTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001273.2-5514s21c1
Sequence:CCGGCGAAGGTTTAAGCTCTTAGAACTCGAGTTCTAAGAGCTTAAACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001273.2-6174s21c1
Sequence:GTACCGGGCCTGTTACACACAAACTGTTCTCGAGAACAGTTTGTGTGTAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001273.2-6332s21c1
Sequence:GTACCGGGCTACCTCTGTTGGCATCTTTCTCGAGAAAGATGCCAACAGAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001273.2-6200s21c1
Sequence:GTACCGGTTCCTGCCAGGCTTGAAGAAACTCGAGTTTCTTCAAGCCTGGCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001273.1-4565s1c1
Sequence:CCGGCCTTACTAGAATTGGTGTTATCTCGAGATAACACCAATTCTAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001273.1-2630s1c1
Sequence:CCGGGCTGCTGACATCCTATGAATTCTCGAGAATTCATAGGATGTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001273.1-716s1c1
Sequence:CCGGGCGGGAGTTCAGTACCAATAACTCGAGTTATTGGTACTGAACTCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001273.1-3501s1c1
Sequence:CCGGGCTGACACAGTTATTATCTATCTCGAGATAGATAATAACTGTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001273.1-5439s1c1
Sequence:CCGGCGAAGGTTTAAGCTCTTAGAACTCGAGTTCTAAGAGCTTAAACCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001273
VALIDATED
CHD4 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001273.2-6007s21c1
Sequence:GTACCGGGCCCATCTTCCATGTTGTAAACTCGAGTTTACAACATGGAAGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001273.2-4640s21c1
Sequence:CCGGCCTTACTAGAATTGGTGTTATCTCGAGATAACACCAATTCTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001273.2-2705s21c1
Sequence:CCGGGCTGCTGACATCCTATGAATTCTCGAGAATTCATAGGATGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001273.2-791s21c1
Sequence:CCGGGCGGGAGTTCAGTACCAATAACTCGAGTTATTGGTACTGAACTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001273.2-5514s21c1
Sequence:CCGGCGAAGGTTTAAGCTCTTAGAACTCGAGTTCTAAGAGCTTAAACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001273.2-6174s21c1
Sequence:GTACCGGGCCTGTTACACACAAACTGTTCTCGAGAACAGTTTGTGTGTAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001273.2-6332s21c1
Sequence:GTACCGGGCTACCTCTGTTGGCATCTTTCTCGAGAAAGATGCCAACAGAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001273.2-6200s21c1
Sequence:GTACCGGTTCCTGCCAGGCTTGAAGAAACTCGAGTTTCTTCAAGCCTGGCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001273.1-4565s1c1
Sequence:CCGGCCTTACTAGAATTGGTGTTATCTCGAGATAACACCAATTCTAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001273.1-2630s1c1
Sequence:CCGGGCTGCTGACATCCTATGAATTCTCGAGAATTCATAGGATGTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001273.1-716s1c1
Sequence:CCGGGCGGGAGTTCAGTACCAATAACTCGAGTTATTGGTACTGAACTCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001273.1-3501s1c1
Sequence:CCGGGCTGACACAGTTATTATCTATCTCGAGATAGATAATAACTGTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001273.1-5439s1c1
Sequence:CCGGCGAAGGTTTAAGCTCTTAGAACTCGAGTTCTAAGAGCTTAAACCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001273
VALIDATED
CHD4 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001273.2-6007s21c1
Sequence:GTACCGGGCCCATCTTCCATGTTGTAAACTCGAGTTTACAACATGGAAGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001273.2-4640s21c1
Sequence:CCGGCCTTACTAGAATTGGTGTTATCTCGAGATAACACCAATTCTAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001273.2-2705s21c1
Sequence:CCGGGCTGCTGACATCCTATGAATTCTCGAGAATTCATAGGATGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001273.2-791s21c1
Sequence:CCGGGCGGGAGTTCAGTACCAATAACTCGAGTTATTGGTACTGAACTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001273.2-5514s21c1
Sequence:CCGGCGAAGGTTTAAGCTCTTAGAACTCGAGTTCTAAGAGCTTAAACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001273.2-6174s21c1
Sequence:GTACCGGGCCTGTTACACACAAACTGTTCTCGAGAACAGTTTGTGTGTAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001273.2-6332s21c1
Sequence:GTACCGGGCTACCTCTGTTGGCATCTTTCTCGAGAAAGATGCCAACAGAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001273.2-6200s21c1
Sequence:GTACCGGTTCCTGCCAGGCTTGAAGAAACTCGAGTTTCTTCAAGCCTGGCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001273.1-4565s1c1
Sequence:CCGGCCTTACTAGAATTGGTGTTATCTCGAGATAACACCAATTCTAGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001273.1-2630s1c1
Sequence:CCGGGCTGCTGACATCCTATGAATTCTCGAGAATTCATAGGATGTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001273.1-716s1c1
Sequence:CCGGGCGGGAGTTCAGTACCAATAACTCGAGTTATTGGTACTGAACTCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001273.1-3501s1c1
Sequence:CCGGGCTGACACAGTTATTATCTATCTCGAGATAGATAATAACTGTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001273.1-5439s1c1
Sequence:CCGGCGAAGGTTTAAGCTCTTAGAACTCGAGTTCTAAGAGCTTAAACCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145979
VALIDATED
CHD4 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145979.2-6029s21c1
Sequence:CCGGGCCCATCTTCTGAGTTGTAAACTCGAGTTTACAACTCAGAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145979.2-5533s21c1
Sequence:CCGGGCTCGAAGATTCAAGCTCTTACTCGAGTAAGAGCTTGAATCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145979.2-3183s21c1
Sequence:CCGGGAACGTGGTGATGGATCTTAACTCGAGTTAAGATCCATCACCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145979.2-1081s21c1
Sequence:CCGGTCGAGTGAGGACGACGATTTACTCGAGTAAATCGTCGTCCTCACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145979.2-3117s21c1
Sequence:CCGGGTATATTCTCACGCGGAATTTCTCGAGAAATTCCGCGTGAGAATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145979.1-6029s1c1
Sequence:CCGGGCCCATCTTCTGAGTTGTAAACTCGAGTTTACAACTCAGAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145979.1-4328s1c1
Sequence:CCGGGCCTGCGGAATGATAAAGATACTCGAGTATCTTTATCATTCCGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145979.1-2917s1c1
Sequence:CCGGCCTGAGAGGTTCCACAACTTACTCGAGTAAGTTGTGGAACCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145979.1-5533s1c1
Sequence:CCGGGCTCGAAGATTCAAGCTCTTACTCGAGTAAGAGCTTGAATCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145979.1-4329s1c1
Sequence:CCGGCCTGCGGAATGATAAAGATAACTCGAGTTATCTTTATCATTCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145979
VALIDATED
CHD4 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145979.2-6029s21c1
Sequence:CCGGGCCCATCTTCTGAGTTGTAAACTCGAGTTTACAACTCAGAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145979.2-5533s21c1
Sequence:CCGGGCTCGAAGATTCAAGCTCTTACTCGAGTAAGAGCTTGAATCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145979.2-3183s21c1
Sequence:CCGGGAACGTGGTGATGGATCTTAACTCGAGTTAAGATCCATCACCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145979.2-1081s21c1
Sequence:CCGGTCGAGTGAGGACGACGATTTACTCGAGTAAATCGTCGTCCTCACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145979.2-3117s21c1
Sequence:CCGGGTATATTCTCACGCGGAATTTCTCGAGAAATTCCGCGTGAGAATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145979.1-6029s1c1
Sequence:CCGGGCCCATCTTCTGAGTTGTAAACTCGAGTTTACAACTCAGAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145979.1-4328s1c1
Sequence:CCGGGCCTGCGGAATGATAAAGATACTCGAGTATCTTTATCATTCCGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145979.1-2917s1c1
Sequence:CCGGCCTGAGAGGTTCCACAACTTACTCGAGTAAGTTGTGGAACCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145979.1-5533s1c1
Sequence:CCGGGCTCGAAGATTCAAGCTCTTACTCGAGTAAGAGCTTGAATCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145979.1-4329s1c1
Sequence:CCGGCCTGCGGAATGATAAAGATAACTCGAGTTATCTTTATCATTCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145979
VALIDATED
CHD4 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145979.2-6029s21c1
Sequence:CCGGGCCCATCTTCTGAGTTGTAAACTCGAGTTTACAACTCAGAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145979.2-5533s21c1
Sequence:CCGGGCTCGAAGATTCAAGCTCTTACTCGAGTAAGAGCTTGAATCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145979.2-3183s21c1
Sequence:CCGGGAACGTGGTGATGGATCTTAACTCGAGTTAAGATCCATCACCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145979.2-1081s21c1
Sequence:CCGGTCGAGTGAGGACGACGATTTACTCGAGTAAATCGTCGTCCTCACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145979.2-3117s21c1
Sequence:CCGGGTATATTCTCACGCGGAATTTCTCGAGAAATTCCGCGTGAGAATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145979.1-6029s1c1
Sequence:CCGGGCCCATCTTCTGAGTTGTAAACTCGAGTTTACAACTCAGAAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145979.1-4328s1c1
Sequence:CCGGGCCTGCGGAATGATAAAGATACTCGAGTATCTTTATCATTCCGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145979.1-2917s1c1
Sequence:CCGGCCTGAGAGGTTCCACAACTTACTCGAGTAAGTTGTGGAACCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145979.1-5533s1c1
Sequence:CCGGGCTCGAAGATTCAAGCTCTTACTCGAGTAAGAGCTTGAATCTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145979.1-4329s1c1
Sequence:CCGGCCTGCGGAATGATAAAGATAACTCGAGTTATCTTTATCATTCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks