EMAIL THIS PAGE TO A FRIEND

CHD5

chromodomain helicase DNA binding protein 5

70 Gene Product Result for
Synonyms: CHD-5
UniProtKB ID: Q8TDI0, O75032, Q5TG89, Q7LGH2, Q9UFR9
Gene ID:
Human(26038) Summary: This gene encodes a member of the chromodomain helicase DNA-binding protein family. Members of this family are characterized by a chromodomain, a helicase ATP-binding domain and an additional functional domain. This gene encodes a neuron-specific protein that may function in chromatin remodeling and gene transcription. This gene is a potential tumor suppressor gene that may play a role in the development of neuroblastoma. [provided by RefSeq, Feb 2012]
Mouse(269610) chromodomain helicase DNA binding protein 5
Rat(691589) chromodomain helicase DNA binding protein 5
Zebrafish(553422) chromodomain helicase DNA binding protein 5
cow(530880) chromodomain helicase DNA binding protein 5
Horse(100059711) chromodomain helicase DNA binding protein 5
domestic cat(101092869) chromodomain helicase DNA binding protein 5
dog(489627) chromodomain helicase DNA binding protein 5
chicken(100857108) chromodomain helicase DNA binding protein 5
domestic guinea pig(100735005) chromodomain helicase DNA binding protein 5
naked mole-rat(101708745) chromodomain helicase DNA binding protein 5
sheep(101118206) chromodomain helicase DNA binding protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015557 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081376 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081376 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081376 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015557 Rosetta Predictions human pricing
XM_001078944 Rosetta Predictions rat pricing
NM_001081376 Rosetta Predictions mouse pricing
NM_029216 Rosetta Predictions mouse pricing
XM_902432 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213203 predicted 4485
2 SASI_Hs01_00213204 predicted 2994
3 SASI_Hs01_00213205 predicted 5473
4 SASI_Hs01_00213206 predicted 2689
5 SASI_Hs01_00213207 predicted 4648
6 SASI_Hs01_00213208 predicted 5954
7 SASI_Hs01_00213209 predicted 4197
8 SASI_Hs01_00213210 predicted 5094
9 SASI_Hs01_00213211 predicted 2510
10 SASI_Hs01_00213212 predicted 3916
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078944 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362585 predicted 2193
2 SASI_Rn02_00362586 predicted 1996
3 SASI_Rn02_00362587 predicted 863
4 SASI_Rn02_00362588 predicted 2402
5 SASI_Rn02_00362589 predicted 1731
6 SASI_Rn02_00362590 predicted 1681
7 SASI_Rn02_00362591 predicted 2182
8 SASI_Rn02_00362592 predicted 1711
9 SASI_Rn02_00362593 predicted 2438
10 SASI_Rn02_00362594 predicted 5583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297811 predicted 4686
2 SASI_Mm02_00297812 predicted 5576
3 SASI_Mm02_00297813 predicted 2192
4 SASI_Mm02_00297814 predicted 2044
5 SASI_Mm02_00297815 predicted 2735
6 SASI_Mm02_00297816 predicted 1176
7 SASI_Mm02_00297817 predicted 2309
8 SASI_Mm02_00297818 predicted 2500
9 SASI_Mm02_00297819 predicted 4481
10 SASI_Mm02_00297820 predicted 6142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335003 predicted 4571
2 SASI_Mm02_00335004 predicted 5469
3 SASI_Mm02_00335005 predicted 2191
4 SASI_Mm02_00335006 predicted 2039
5 SASI_Mm02_00335007 predicted 2732
6 SASI_Mm02_00335008 predicted 1182
7 SASI_Mm02_00335009 predicted 2316
8 SASI_Mm02_00335010 predicted 2499
9 SASI_Mm02_00335011 predicted 4369
10 SASI_Mm02_00335012 predicted 6040
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278951 predicted 5584
2 SASI_Mm01_00278952 predicted 5851
3 SASI_Mm01_00278953 predicted 6038
4 SASI_Mm01_00278954 predicted 6048
5 SASI_Mm01_00278955 predicted 5605
6 SASI_Mm01_00278956 predicted 5919
7 SASI_Mm01_00278957 predicted 5539
8 SASI_Mm01_00278958 predicted 5533
9 SASI_Mm01_00278959 predicted 5762
10 SASI_Mm01_00278960 predicted 6155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015557
CHD5 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015557.1-1886s1c1
Sequence:CCGGCGAATCCTGAACCATAGCTTTCTCGAGAAAGCTATGGTTCAGGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015557.1-5443s1c1
Sequence:CCGGCCTGGAGATGAAGAACAAGTTCTCGAGAACTTGTTCTTCATCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015557.1-2308s1c1
Sequence:CCGGCGTGTTCCTTTACTCCCTCTACTCGAGTAGAGGGAGTAAAGGAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015557.1-1079s1c1
Sequence:CCGGCGCAAGAAGAAGAGGATTGATCTCGAGATCAATCCTCTTCTTCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015557.1-6159s21c1
Sequence:CCGGGAAGTGCCACCTCATCATAATCTCGAGATTATGATGAGGTGGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015557.1-5982s21c1
Sequence:CCGGCCTGTGTTGCAGCGCTCATTTCTCGAGAAATGAGCGCTGCAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015557.1-4198s21c1
Sequence:CCGGTGATAACCAGTCAGAATATTCCTCGAGGAATATTCTGACTGGTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015557.1-2536s21c1
Sequence:CCGGGAAAGAAGTGCAGATCAAATTCTCGAGAATTTGATCTGCACTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015557
CHD5 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015557.1-1886s1c1
Sequence:CCGGCGAATCCTGAACCATAGCTTTCTCGAGAAAGCTATGGTTCAGGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015557.1-5443s1c1
Sequence:CCGGCCTGGAGATGAAGAACAAGTTCTCGAGAACTTGTTCTTCATCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015557.1-2308s1c1
Sequence:CCGGCGTGTTCCTTTACTCCCTCTACTCGAGTAGAGGGAGTAAAGGAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015557.1-1079s1c1
Sequence:CCGGCGCAAGAAGAAGAGGATTGATCTCGAGATCAATCCTCTTCTTCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015557.1-6159s21c1
Sequence:CCGGGAAGTGCCACCTCATCATAATCTCGAGATTATGATGAGGTGGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015557.1-5982s21c1
Sequence:CCGGCCTGTGTTGCAGCGCTCATTTCTCGAGAAATGAGCGCTGCAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015557.1-4198s21c1
Sequence:CCGGTGATAACCAGTCAGAATATTCCTCGAGGAATATTCTGACTGGTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015557.1-2536s21c1
Sequence:CCGGGAAAGAAGTGCAGATCAAATTCTCGAGAATTTGATCTGCACTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015557
CHD5 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015557.1-1886s1c1
Sequence:CCGGCGAATCCTGAACCATAGCTTTCTCGAGAAAGCTATGGTTCAGGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015557.1-5443s1c1
Sequence:CCGGCCTGGAGATGAAGAACAAGTTCTCGAGAACTTGTTCTTCATCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015557.1-2308s1c1
Sequence:CCGGCGTGTTCCTTTACTCCCTCTACTCGAGTAGAGGGAGTAAAGGAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015557.1-1079s1c1
Sequence:CCGGCGCAAGAAGAAGAGGATTGATCTCGAGATCAATCCTCTTCTTCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015557.1-6159s21c1
Sequence:CCGGGAAGTGCCACCTCATCATAATCTCGAGATTATGATGAGGTGGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015557.1-5982s21c1
Sequence:CCGGCCTGTGTTGCAGCGCTCATTTCTCGAGAAATGAGCGCTGCAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015557.1-4198s21c1
Sequence:CCGGTGATAACCAGTCAGAATATTCCTCGAGGAATATTCTGACTGGTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015557.1-2536s21c1
Sequence:CCGGGAAAGAAGTGCAGATCAAATTCTCGAGAATTTGATCTGCACTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081376
CHD5 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081376.1-895s21c1
Sequence:CCGGCAGCGCCAACAACCCGTTTAACTCGAGTTAAACGGGTTGTTGGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081376.1-3489s21c1
Sequence:CCGGAGTACGAGGGCTACAAGTATGCTCGAGCATACTTGTAGCCCTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081376.1-3240s21c1
Sequence:CCGGACCAGGTGTCTCTACTCAATACTCGAGTATTGAGTAGAGACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081376.1-9007s21c1
Sequence:CCGGTTTGGTGTCCCTGCGTTTATGCTCGAGCATAAACGCAGGGACACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081376.1-4404s21c1
Sequence:CCGGCGGACAACCAGTCGGAGTATTCTCGAGAATACTCCGACTGGTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081376
CHD5 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081376.1-895s21c1
Sequence:CCGGCAGCGCCAACAACCCGTTTAACTCGAGTTAAACGGGTTGTTGGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081376.1-3489s21c1
Sequence:CCGGAGTACGAGGGCTACAAGTATGCTCGAGCATACTTGTAGCCCTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081376.1-3240s21c1
Sequence:CCGGACCAGGTGTCTCTACTCAATACTCGAGTATTGAGTAGAGACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081376.1-9007s21c1
Sequence:CCGGTTTGGTGTCCCTGCGTTTATGCTCGAGCATAAACGCAGGGACACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081376.1-4404s21c1
Sequence:CCGGCGGACAACCAGTCGGAGTATTCTCGAGAATACTCCGACTGGTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081376
CHD5 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081376.1-895s21c1
Sequence:CCGGCAGCGCCAACAACCCGTTTAACTCGAGTTAAACGGGTTGTTGGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081376.1-3489s21c1
Sequence:CCGGAGTACGAGGGCTACAAGTATGCTCGAGCATACTTGTAGCCCTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081376.1-3240s21c1
Sequence:CCGGACCAGGTGTCTCTACTCAATACTCGAGTATTGAGTAGAGACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081376.1-9007s21c1
Sequence:CCGGTTTGGTGTCCCTGCGTTTATGCTCGAGCATAAACGCAGGGACACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081376.1-4404s21c1
Sequence:CCGGCGGACAACCAGTCGGAGTATTCTCGAGAATACTCCGACTGGTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks