EMAIL THIS PAGE TO A FRIEND

CHD6

chromodomain helicase DNA binding protein 6

Synonyms: CHD-6 CHD5 RIGB
Gene ID:
Human(84181) Summary: Chromosomal DNA of eukaryotic cells is compacted by nuclear proteins to form chromatin, an organized nucleoprotein structure that can inhibit gene expression. Several multisubunit protein complexes exist to remodel the chromatin to allow patterns of cell type-specific gene expression. The protein encoded by this gene is thought to be a core member of one or more of these complexes. The encoded protein, which is a member of the SNF2/RAD54 helicase family, contains two chromodomains, a helicase domain, and an ATPase domain. [provided by RefSeq, Jul 2008]
Mouse(71389) chromodomain helicase DNA binding protein 6
Rat(311607) chromodomain helicase DNA binding protein 6
sheep(101104333) chromodomain helicase DNA binding protein 6
Domestic Rabbit(100350694) chromodomain helicase DNA binding protein 6
naked mole-rat(101721296) chromodomain helicase DNA binding protein 6
domestic guinea pig(100734056) chromodomain helicase DNA binding protein 6
Zebrafish(570753) chromodomain helicase DNA binding protein 6
chicken(419127) chromodomain helicase DNA binding protein 6
Horse(100055799) chromodomain helicase DNA binding protein 6
cow(524776) chromodomain helicase DNA binding protein 6
domestic cat(101092174) chromodomain helicase DNA binding protein 6
dog(477230) chromodomain helicase DNA binding protein 6
139 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032221 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173368 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173368 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173368 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073411 MISSION® esiRNA esiRNA human CHD6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032221 Rosetta Predictions human pricing
NM_001107797 Rosetta Predictions rat pricing
NM_173368 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208760 predicted 1994
2 SASI_Hs02_00359519 predicted 7963
3 SASI_Hs01_00208762 predicted 4774
4 SASI_Hs02_00359520 predicted 1809
5 SASI_Hs01_00208763 predicted 2359
6 SASI_Hs01_00208764 predicted 6453
7 SASI_Hs01_00208765 predicted 3836
8 SASI_Hs01_00208766 predicted 7834
9 SASI_Hs01_00208767 predicted 2655
10 SASI_Hs01_00208768 predicted 1168
11 SASI_Hs01_00208761 predicted 449
12 SASI_Hs01_00208769 predicted 6537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232365 predicted 4984
2 SASI_Rn02_00232366 predicted 1759
3 SASI_Rn02_00232367 predicted 6342
4 SASI_Rn02_00232368 predicted 1738
5 SASI_Rn02_00232369 predicted 2813
6 SASI_Rn02_00232370 predicted 2586
7 SASI_Rn02_00232371 predicted 3358
8 SASI_Rn02_00232372 predicted 6859
9 SASI_Rn02_00232373 predicted 4432
10 SASI_Rn02_00232374 predicted 7652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173368 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164381 predicted 1735
2 SASI_Mm01_00164382 predicted 5884
3 SASI_Mm01_00164383 predicted 5215
4 SASI_Mm01_00164384 predicted 1642
5 SASI_Mm02_00345178 predicted 8203
6 SASI_Mm02_00345179 predicted 7416
7 SASI_Mm01_00164385 predicted 2567
8 SASI_Mm01_00164386 predicted 5548
9 SASI_Mm01_00164387 predicted 2150
10 SASI_Mm01_00164388 predicted 2795
11 SASI_Mm01_00164389 predicted 6247
12 SASI_Mm01_00164390 predicted 6373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032221
VALIDATED
CHD6 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 6
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032221.3-8566s21c1
Sequence:CCGGCATTCCAGCAATCATAGTTAACTCGAGTTAACTATGATTGCTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032221.3-10053s21c1
Sequence:CCGGGTAGCATAGATGGTCTATAATCTCGAGATTATAGACCATCTATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-6128s21c1
Sequence:CCGGATTCCATCACAGCCGTTTAAACTCGAGTTTAAACGGCTGTGATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-5077s21c1
Sequence:CCGGCCAGACCAACTCCAAGTTATACTCGAGTATAACTTGGAGTTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-3815s21c1
Sequence:CCGGTTGCATGATGATGGCTATAAGCTCGAGCTTATAGCCATCATCATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-2002s21c1
Sequence:CCGGCAAACTTCTGGAGGGTCTAAACTCGAGTTTAGACCCTCCAGAAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-1889s21c1
Sequence:CCGGCACGTCGTCATCACAACATTTCTCGAGAAATGTTGTGATGACGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-2646s21c1
Sequence:CCGGGATACACCTATGAGCGAATTGCTCGAGCAATTCGCTCATAGGTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032221.3-8403s1c1
Sequence:CCGGCCTCCATAAGAACCTGTGTTTCTCGAGAAACACAGGTTCTTATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032221.3-2255s1c1
Sequence:CCGGCCCAAACAAGAGACGATCATTCTCGAGAATGATCGTCTCTTGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032221.3-4784s1c1
Sequence:CCGGGCAAGAACTCTGTACCGCATTCTCGAGAATGCGGTACAGAGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032221.3-4799s1c1
Sequence:CCGGCGCATTGAACTGTTACGGAAACTCGAGTTTCCGTAACAGTTCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032221.3-1211s1c1
Sequence:CCGGGCACAGAAGATCAAGCGATTTCTCGAGAAATCGCTTGATCTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032221
VALIDATED
CHD6 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 6
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032221.3-8566s21c1
Sequence:CCGGCATTCCAGCAATCATAGTTAACTCGAGTTAACTATGATTGCTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032221.3-10053s21c1
Sequence:CCGGGTAGCATAGATGGTCTATAATCTCGAGATTATAGACCATCTATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-6128s21c1
Sequence:CCGGATTCCATCACAGCCGTTTAAACTCGAGTTTAAACGGCTGTGATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-5077s21c1
Sequence:CCGGCCAGACCAACTCCAAGTTATACTCGAGTATAACTTGGAGTTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-3815s21c1
Sequence:CCGGTTGCATGATGATGGCTATAAGCTCGAGCTTATAGCCATCATCATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-2002s21c1
Sequence:CCGGCAAACTTCTGGAGGGTCTAAACTCGAGTTTAGACCCTCCAGAAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-1889s21c1
Sequence:CCGGCACGTCGTCATCACAACATTTCTCGAGAAATGTTGTGATGACGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-2646s21c1
Sequence:CCGGGATACACCTATGAGCGAATTGCTCGAGCAATTCGCTCATAGGTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032221.3-8403s1c1
Sequence:CCGGCCTCCATAAGAACCTGTGTTTCTCGAGAAACACAGGTTCTTATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032221.3-2255s1c1
Sequence:CCGGCCCAAACAAGAGACGATCATTCTCGAGAATGATCGTCTCTTGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032221.3-4784s1c1
Sequence:CCGGGCAAGAACTCTGTACCGCATTCTCGAGAATGCGGTACAGAGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032221.3-4799s1c1
Sequence:CCGGCGCATTGAACTGTTACGGAAACTCGAGTTTCCGTAACAGTTCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032221.3-1211s1c1
Sequence:CCGGGCACAGAAGATCAAGCGATTTCTCGAGAAATCGCTTGATCTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032221
VALIDATED
CHD6 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 6
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032221.3-8566s21c1
Sequence:CCGGCATTCCAGCAATCATAGTTAACTCGAGTTAACTATGATTGCTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032221.3-10053s21c1
Sequence:CCGGGTAGCATAGATGGTCTATAATCTCGAGATTATAGACCATCTATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-6128s21c1
Sequence:CCGGATTCCATCACAGCCGTTTAAACTCGAGTTTAAACGGCTGTGATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-5077s21c1
Sequence:CCGGCCAGACCAACTCCAAGTTATACTCGAGTATAACTTGGAGTTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-3815s21c1
Sequence:CCGGTTGCATGATGATGGCTATAAGCTCGAGCTTATAGCCATCATCATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-2002s21c1
Sequence:CCGGCAAACTTCTGGAGGGTCTAAACTCGAGTTTAGACCCTCCAGAAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-1889s21c1
Sequence:CCGGCACGTCGTCATCACAACATTTCTCGAGAAATGTTGTGATGACGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032221.3-2646s21c1
Sequence:CCGGGATACACCTATGAGCGAATTGCTCGAGCAATTCGCTCATAGGTGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032221.3-8403s1c1
Sequence:CCGGCCTCCATAAGAACCTGTGTTTCTCGAGAAACACAGGTTCTTATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032221.3-2255s1c1
Sequence:CCGGCCCAAACAAGAGACGATCATTCTCGAGAATGATCGTCTCTTGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032221.3-4784s1c1
Sequence:CCGGGCAAGAACTCTGTACCGCATTCTCGAGAATGCGGTACAGAGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032221.3-4799s1c1
Sequence:CCGGCGCATTGAACTGTTACGGAAACTCGAGTTTCCGTAACAGTTCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032221.3-1211s1c1
Sequence:CCGGGCACAGAAGATCAAGCGATTTCTCGAGAAATCGCTTGATCTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173368
VALIDATED
CHD6 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173368.2-4865s21c1
Sequence:CCGGCTCAACCGCACTGACTATTACCTCGAGGTAATAGTCAGTGCGGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173368.2-1912s21c1
Sequence:CCGGCAAACTTCTGGAAGGGTTAAACTCGAGTTTAACCCTTCCAGAAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173368.2-9925s21c1
Sequence:CCGGCGGCTGTTAAATCCTAAAGATCTCGAGATCTTTAGGATTTAACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173368.2-7423s21c2
Sequence:CCGGGCCTCGAAATGAACTCCTAAACTCGAGTTTAGGAGTTCATTTCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173368.2-4282s21c1
Sequence:CCGGCAGGCGTCTGGTCACTATTTACTCGAGTAAATAGTGACCAGACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173368.2-9925s1c1
Sequence:CCGGCGGCTGTTAAATCCTAAAGATCTCGAGATCTTTAGGATTTAACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173368.2-7423s1c1
Sequence:CCGGGCCTCGAAATGAACTCCTAAACTCGAGTTTAGGAGTTCATTTCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173368.2-2791s1c1
Sequence:CCGGCGTGAAGGTATATCGCCTAATCTCGAGATTAGGCGATATACCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173368.2-5345s1c1
Sequence:CCGGCCTGGTATTGAGGCAGAAATTCTCGAGAATTTCTGCCTCAATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173368.2-1443s1c1
Sequence:CCGGCCCGTGAGTATAGGAACAGTACTCGAGTACTGTTCCTATACTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173368
VALIDATED
CHD6 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173368.2-4865s21c1
Sequence:CCGGCTCAACCGCACTGACTATTACCTCGAGGTAATAGTCAGTGCGGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173368.2-1912s21c1
Sequence:CCGGCAAACTTCTGGAAGGGTTAAACTCGAGTTTAACCCTTCCAGAAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173368.2-9925s21c1
Sequence:CCGGCGGCTGTTAAATCCTAAAGATCTCGAGATCTTTAGGATTTAACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173368.2-7423s21c2
Sequence:CCGGGCCTCGAAATGAACTCCTAAACTCGAGTTTAGGAGTTCATTTCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173368.2-4282s21c1
Sequence:CCGGCAGGCGTCTGGTCACTATTTACTCGAGTAAATAGTGACCAGACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173368.2-9925s1c1
Sequence:CCGGCGGCTGTTAAATCCTAAAGATCTCGAGATCTTTAGGATTTAACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173368.2-7423s1c1
Sequence:CCGGGCCTCGAAATGAACTCCTAAACTCGAGTTTAGGAGTTCATTTCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173368.2-2791s1c1
Sequence:CCGGCGTGAAGGTATATCGCCTAATCTCGAGATTAGGCGATATACCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173368.2-5345s1c1
Sequence:CCGGCCTGGTATTGAGGCAGAAATTCTCGAGAATTTCTGCCTCAATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173368.2-1443s1c1
Sequence:CCGGCCCGTGAGTATAGGAACAGTACTCGAGTACTGTTCCTATACTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173368
VALIDATED
CHD6 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173368.2-4865s21c1
Sequence:CCGGCTCAACCGCACTGACTATTACCTCGAGGTAATAGTCAGTGCGGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173368.2-1912s21c1
Sequence:CCGGCAAACTTCTGGAAGGGTTAAACTCGAGTTTAACCCTTCCAGAAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173368.2-9925s21c1
Sequence:CCGGCGGCTGTTAAATCCTAAAGATCTCGAGATCTTTAGGATTTAACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173368.2-7423s21c2
Sequence:CCGGGCCTCGAAATGAACTCCTAAACTCGAGTTTAGGAGTTCATTTCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173368.2-4282s21c1
Sequence:CCGGCAGGCGTCTGGTCACTATTTACTCGAGTAAATAGTGACCAGACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173368.2-9925s1c1
Sequence:CCGGCGGCTGTTAAATCCTAAAGATCTCGAGATCTTTAGGATTTAACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173368.2-7423s1c1
Sequence:CCGGGCCTCGAAATGAACTCCTAAACTCGAGTTTAGGAGTTCATTTCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173368.2-2791s1c1
Sequence:CCGGCGTGAAGGTATATCGCCTAATCTCGAGATTAGGCGATATACCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173368.2-5345s1c1
Sequence:CCGGCCTGGTATTGAGGCAGAAATTCTCGAGAATTTCTGCCTCAATACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173368.2-1443s1c1
Sequence:CCGGCCCGTGAGTATAGGAACAGTACTCGAGTACTGTTCCTATACTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks