EMAIL THIS PAGE TO A FRIEND

CHD8

chromodomain helicase DNA binding protein 8

Synonyms: AUTS18 HELSNF1
Gene ID:
Human(57680) Summary: This gene encodes a DNA helicase that functions as a transcription repressor by remodeling chromatin structure. It binds beta-catenin and negatively regulates Wnt signaling pathway, which plays a pivotal role in vertebrate early development and morphogenesis. Mice lacking this gene exhibit early embryonic death. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Mouse(67772) chromodomain helicase DNA binding protein 8
Rat(65027) chromodomain helicase DNA binding protein 8
sheep(101109181) chromodomain helicase DNA binding protein 8
naked mole-rat(101698950) chromodomain helicase DNA binding protein 8
domestic guinea pig(100713580) chromodomain helicase DNA binding protein 8
Zebrafish(568214) chromodomain helicase DNA binding protein 8
dog(475401) chromodomain helicase DNA binding protein 8
Horse(100059337) chromodomain helicase DNA binding protein 8
cow(507111) chromodomain helicase DNA binding protein 8
domestic cat(101097402) chromodomain helicase DNA binding protein 8
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020920 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201637 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201637 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201637 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_370738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_370738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_370738 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144761 MISSION® esiRNA esiRNA human CHD8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020920 Rosetta Predictions human pricing
NM_022933 Rosetta Predictions rat pricing
NM_201637 Rosetta Predictions mouse pricing
XM_619244 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194443 predicted 3805
2 SASI_Hs02_00354286 predicted 1274
3 SASI_Hs02_00354287 predicted 632
4 SASI_Hs01_00194444 predicted 2002
5 SASI_Hs01_00194445 predicted 4680
6 SASI_Hs01_00194446 predicted 1295
7 SASI_Hs02_00354288 predicted 4787
8 SASI_Hs01_00194447 predicted 2512
9 SASI_Hs01_00194448 predicted 4065
10 SASI_Hs02_00354289 predicted 1272
11 SASI_Hs01_00194449 predicted 1865
12 SASI_Hs01_00194450 predicted 4099
13 SASI_Hs01_00194451 predicted 1643
14 SASI_Hs01_00194452 predicted 1714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022933 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263627 predicted 5767
2 SASI_Rn02_00263628 predicted 5889
3 SASI_Rn02_00263629 predicted 2661
4 SASI_Rn02_00263630 predicted 4248
5 SASI_Rn02_00263631 predicted 3711
6 SASI_Rn02_00263632 predicted 966
7 SASI_Rn02_00263633 predicted 5051
8 SASI_Rn02_00263634 predicted 3202
9 SASI_Rn02_00263635 predicted 2358
10 SASI_Rn02_00263636 predicted 4794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351688 predicted 5531
2 SASI_Mm02_00351689 predicted 2431
3 SASI_Mm02_00351690 predicted 5365
4 SASI_Mm02_00351691 predicted 4866
5 SASI_Mm02_00351692 predicted 3095
6 SASI_Mm02_00351693 predicted 4565
7 SASI_Mm02_00351694 predicted 4819
8 SASI_Mm02_00351695 predicted 5465
9 SASI_Mm02_00351696 predicted 1626
10 SASI_Mm02_00351697 predicted 4404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280977 predicted 5532
2 SASI_Mm01_00280978 predicted 5365
3 SASI_Mm01_00280979 predicted 5421
4 SASI_Mm01_00280980 predicted 4864
5 SASI_Mm01_00280981 predicted 6490
6 SASI_Mm01_00280982 predicted 4563
7 SASI_Mm01_00280983 predicted 6779
8 SASI_Mm01_00280984 predicted 5440
9 SASI_Mm01_00280985 predicted 4827
10 SASI_Mm01_00280986 predicted 5476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020920
CHD8 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 8
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000367896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020920.2-2593s21c1
Sequence:CCGGCCGTGAAGCTTGCCATATTATCTCGAGATAATATGGCAAGCTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020920.2-3902s21c1
Sequence:CCGGGCAGATTGGATCCGGAAATATCTCGAGATATTTCCGGATCCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020920.2-2742s21c1
Sequence:CCGGTAGACATCCTAGAGGATTATTCTCGAGAATAATCCTCTAGGATGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020920
CHD8 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 8
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000367896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020920.2-2593s21c1
Sequence:CCGGCCGTGAAGCTTGCCATATTATCTCGAGATAATATGGCAAGCTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020920.2-3902s21c1
Sequence:CCGGGCAGATTGGATCCGGAAATATCTCGAGATATTTCCGGATCCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020920.2-2742s21c1
Sequence:CCGGTAGACATCCTAGAGGATTATTCTCGAGAATAATCCTCTAGGATGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020920
CHD8 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 8
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000367896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020920.2-2593s21c1
Sequence:CCGGCCGTGAAGCTTGCCATATTATCTCGAGATAATATGGCAAGCTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020920.2-3902s21c1
Sequence:CCGGGCAGATTGGATCCGGAAATATCTCGAGATATTTCCGGATCCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020920.2-2742s21c1
Sequence:CCGGTAGACATCCTAGAGGATTATTCTCGAGAATAATCCTCTAGGATGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201637
CHD8 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 8
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201637.2-847s1c1
Sequence:CCGGGAATCGAAACGCATCACTTTGCTCGAGCAAAGTGATGCGTTTCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201637.2-3770s21c1
Sequence:CCGGACCGACTCATCACTCGTAATTCTCGAGAATTACGAGTGATGAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201637.2-3342s21c1
Sequence:CCGGTCGGGAAGCTTGCCATATTATCTCGAGATAATATGGCAAGCTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201637.2-1728s21c1
Sequence:CCGGACGTTCAAACCGCCAAGTTAACTCGAGTTAACTTGGCGGTTTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201637.2-7980s21c1
Sequence:CCGGATGACCACTTCCTCGTTTCTGCTCGAGCAGAAACGAGGAAGTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201637.2-1811s21c1
Sequence:CCGGTCGATGTAACTGGTCCAATAACTCGAGTTATTGGACCAGTTACATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201637.1-1439s1c1
Sequence:CCGGGCAGCCTTTAAGCTCAAAGAACTCGAGTTCTTTGAGCTTAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201637
CHD8 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 8
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201637.2-847s1c1
Sequence:CCGGGAATCGAAACGCATCACTTTGCTCGAGCAAAGTGATGCGTTTCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201637.2-3770s21c1
Sequence:CCGGACCGACTCATCACTCGTAATTCTCGAGAATTACGAGTGATGAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201637.2-3342s21c1
Sequence:CCGGTCGGGAAGCTTGCCATATTATCTCGAGATAATATGGCAAGCTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201637.2-1728s21c1
Sequence:CCGGACGTTCAAACCGCCAAGTTAACTCGAGTTAACTTGGCGGTTTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201637.2-7980s21c1
Sequence:CCGGATGACCACTTCCTCGTTTCTGCTCGAGCAGAAACGAGGAAGTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201637.2-1811s21c1
Sequence:CCGGTCGATGTAACTGGTCCAATAACTCGAGTTATTGGACCAGTTACATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201637.1-1439s1c1
Sequence:CCGGGCAGCCTTTAAGCTCAAAGAACTCGAGTTCTTTGAGCTTAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201637
CHD8 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 8
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201637.2-847s1c1
Sequence:CCGGGAATCGAAACGCATCACTTTGCTCGAGCAAAGTGATGCGTTTCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201637.2-3770s21c1
Sequence:CCGGACCGACTCATCACTCGTAATTCTCGAGAATTACGAGTGATGAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201637.2-3342s21c1
Sequence:CCGGTCGGGAAGCTTGCCATATTATCTCGAGATAATATGGCAAGCTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201637.2-1728s21c1
Sequence:CCGGACGTTCAAACCGCCAAGTTAACTCGAGTTAACTTGGCGGTTTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201637.2-7980s21c1
Sequence:CCGGATGACCACTTCCTCGTTTCTGCTCGAGCAGAAACGAGGAAGTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201637.2-1811s21c1
Sequence:CCGGTCGATGTAACTGGTCCAATAACTCGAGTTATTGGACCAGTTACATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201637.1-1439s1c1
Sequence:CCGGGCAGCCTTTAAGCTCAAAGAACTCGAGTTCTTTGAGCTTAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_370738
CHD8 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370738.1-3137s1c1
Sequence:CCGGCCGTCACAATTTCCCTCAGAACTCGAGTTCTGAGGGAAATTGTGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370738.1-7862s1c1
Sequence:CCGGGCTAACTCAGACTCCAGTGAACTCGAGTTCACTGGAGTCTGAGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370738.1-3494s1c1
Sequence:CCGGGCTTGCCATATTATACCTCATCTCGAGATGAGGTATAATATGGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370738.1-4888s1c1
Sequence:CCGGGCGGGTACGAATGCTATACTACTCGAGTAGTATAGCATTCGTACCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370738.1-5231s1c1
Sequence:CCGGCCTGAATATAAACCACTCCAACTCGAGTTGGAGTGGTTTATATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_370738
CHD8 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370738.1-3137s1c1
Sequence:CCGGCCGTCACAATTTCCCTCAGAACTCGAGTTCTGAGGGAAATTGTGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370738.1-7862s1c1
Sequence:CCGGGCTAACTCAGACTCCAGTGAACTCGAGTTCACTGGAGTCTGAGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370738.1-3494s1c1
Sequence:CCGGGCTTGCCATATTATACCTCATCTCGAGATGAGGTATAATATGGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370738.1-4888s1c1
Sequence:CCGGGCGGGTACGAATGCTATACTACTCGAGTAGTATAGCATTCGTACCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370738.1-5231s1c1
Sequence:CCGGCCTGAATATAAACCACTCCAACTCGAGTTGGAGTGGTTTATATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_370738
CHD8 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370738.1-3137s1c1
Sequence:CCGGCCGTCACAATTTCCCTCAGAACTCGAGTTCTGAGGGAAATTGTGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370738.1-7862s1c1
Sequence:CCGGGCTAACTCAGACTCCAGTGAACTCGAGTTCACTGGAGTCTGAGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370738.1-3494s1c1
Sequence:CCGGGCTTGCCATATTATACCTCATCTCGAGATGAGGTATAATATGGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370738.1-4888s1c1
Sequence:CCGGGCGGGTACGAATGCTATACTACTCGAGTAGTATAGCATTCGTACCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370738.1-5231s1c1
Sequence:CCGGCCTGAATATAAACCACTCCAACTCGAGTTGGAGTGGTTTATATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks