EMAIL THIS PAGE TO A FRIEND

CHD9

chromodomain helicase DNA binding protein 9

215 Gene Product Result for
Synonyms: AD013 CReMM KISH2 PRIC320
Gene ID:
Mouse(109151) chromodomain helicase DNA binding protein 9
Rat(307726) chromodomain helicase DNA binding protein 9
Zebrafish(572355) chromodomain helicase DNA binding protein 9
cow(539275) chromodomain helicase DNA binding protein 9
domestic cat(101095145) chromodomain helicase DNA binding protein 9
dog(478128) chromodomain helicase DNA binding protein 9
chicken(415722) chromodomain helicase DNA binding protein 9
domestic guinea pig(100735315) chromodomain helicase DNA binding protein 9
naked mole-rat(101702180) chromodomain helicase DNA binding protein 9
sheep(101114129) chromodomain helicase DNA binding protein 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025134 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177224 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177224 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177224 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025134 Rosetta Predictions human pricing
NM_177224 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123049 predicted 3879
2 SASI_Hs01_00123051 predicted 2532
3 SASI_Hs01_00123053 predicted 3588
4 SASI_Hs01_00123055 predicted 6033
5 SASI_Hs01_00123056 predicted 8655
6 SASI_Hs01_00123057 predicted 718
7 SASI_Hs01_00123058 predicted 254
8 SASI_Hs02_00357847 predicted 4767
9 SASI_Hs02_00357848 predicted 8166
10 SASI_Hs02_00357849 predicted 5311
11 SASI_Hs01_00123050 predicted 1539
12 SASI_Hs01_00123052 predicted 5648
13 SASI_Hs01_00123054 predicted 3755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177224 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347252 predicted 3043
2 SASI_Mm01_00052409 predicted 3585
3 SASI_Mm01_00052410 predicted 5916
4 SASI_Mm01_00052411 predicted 2905
5 SASI_Mm02_00347253 predicted 4013
6 SASI_Mm01_00052412 predicted 3064
7 SASI_Mm01_00052413 predicted 400
8 SASI_Mm01_00052414 predicted 2664
9 SASI_Mm01_00052415 predicted 3748
10 SASI_Mm01_00052417 predicted 7231
11 SASI_Mm01_00052416 predicted 5207
12 SASI_Mm01_00052418 predicted 6360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025134
VALIDATED
CHD9 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 9
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025134.3-9544s1c1
Sequence:CCGGGCAAGAAATATGACTTGCTTTCTCGAGAAAGCAAGTCATATTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025134.3-3705s1c1
Sequence:CCGGGCTGGTAAATTGGTCCTTATTCTCGAGAATAAGGACCAATTTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025134.3-7806s1c1
Sequence:CCGGCCCAATAAACTAGATGTGAATCTCGAGATTCACATCTAGTTTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025134.3-5943s1c1
Sequence:CCGGCGCATTGAACTTCTAAGGAAACTCGAGTTTCCTTAGAAGTTCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025134.3-651s1c1
Sequence:CCGGGCCTTATTTCAGGCCAATGAACTCGAGTTCATTGGCCTGAAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-4805s21c1
Sequence:GTACCGGCCGAGCTCTCTTAGCATATTGCTCGAGCAATATGCTAAGAGAGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025134.4-9219s21c1
Sequence:GTACCGGAGCCTCCTTGACACCTATAATCTCGAGATTATAGGTGTCAAGGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-1510s21c1
Sequence:GTACCGGATGACCTTGATCGGCAGTTTACTCGAGTAAACTGCCGATCAAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-7836s21c1
Sequence:GTACCGGGAACGTGTTCAACTGATTAACCTCGAGGTTAATCAGTTGAACACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-1235s21c1
Sequence:GTACCGGATCACATCCTCAGGGTAATTACTCGAGTAATTACCCTGAGGATGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_025134.4-5579s21c1
Sequence:GTACCGGTGCATACCAGCGTACTAATAACTCGAGTTATTAGTACGCTGGTATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025134.4-11107s21c1
Sequence:CCGGGTGTAAAGTTAAGGGTTATAACTCGAGTTATAACCCTTAACTTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_025134.4-2989s21c1
Sequence:CCGGTTCGTACGTGGACTGATATTACTCGAGTAATATCAGTCCACGTACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_025134.4-2754s21c1
Sequence:CCGGGATCAATCCAGGGACTATAAACTCGAGTTTATAGTCCCTGGATTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-3436s21c1
Sequence:GTACCGGCAATGATGTTGAGACGATTAACTCGAGTTAATCGTCTCAACATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-2166s21c1
Sequence:GTACCGGCAATCTGAAGAAGAGGTTAAACTCGAGTTTAACCTCTTCTTCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025134
VALIDATED
CHD9 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 9
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025134.3-9544s1c1
Sequence:CCGGGCAAGAAATATGACTTGCTTTCTCGAGAAAGCAAGTCATATTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025134.3-3705s1c1
Sequence:CCGGGCTGGTAAATTGGTCCTTATTCTCGAGAATAAGGACCAATTTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025134.3-7806s1c1
Sequence:CCGGCCCAATAAACTAGATGTGAATCTCGAGATTCACATCTAGTTTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025134.3-5943s1c1
Sequence:CCGGCGCATTGAACTTCTAAGGAAACTCGAGTTTCCTTAGAAGTTCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025134.3-651s1c1
Sequence:CCGGGCCTTATTTCAGGCCAATGAACTCGAGTTCATTGGCCTGAAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-4805s21c1
Sequence:GTACCGGCCGAGCTCTCTTAGCATATTGCTCGAGCAATATGCTAAGAGAGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025134.4-9219s21c1
Sequence:GTACCGGAGCCTCCTTGACACCTATAATCTCGAGATTATAGGTGTCAAGGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-1510s21c1
Sequence:GTACCGGATGACCTTGATCGGCAGTTTACTCGAGTAAACTGCCGATCAAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-7836s21c1
Sequence:GTACCGGGAACGTGTTCAACTGATTAACCTCGAGGTTAATCAGTTGAACACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-1235s21c1
Sequence:GTACCGGATCACATCCTCAGGGTAATTACTCGAGTAATTACCCTGAGGATGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_025134.4-5579s21c1
Sequence:GTACCGGTGCATACCAGCGTACTAATAACTCGAGTTATTAGTACGCTGGTATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025134.4-11107s21c1
Sequence:CCGGGTGTAAAGTTAAGGGTTATAACTCGAGTTATAACCCTTAACTTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_025134.4-2989s21c1
Sequence:CCGGTTCGTACGTGGACTGATATTACTCGAGTAATATCAGTCCACGTACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_025134.4-2754s21c1
Sequence:CCGGGATCAATCCAGGGACTATAAACTCGAGTTTATAGTCCCTGGATTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-3436s21c1
Sequence:GTACCGGCAATGATGTTGAGACGATTAACTCGAGTTAATCGTCTCAACATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-2166s21c1
Sequence:GTACCGGCAATCTGAAGAAGAGGTTAAACTCGAGTTTAACCTCTTCTTCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025134
VALIDATED
CHD9 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 9
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025134.3-9544s1c1
Sequence:CCGGGCAAGAAATATGACTTGCTTTCTCGAGAAAGCAAGTCATATTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025134.3-3705s1c1
Sequence:CCGGGCTGGTAAATTGGTCCTTATTCTCGAGAATAAGGACCAATTTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025134.3-7806s1c1
Sequence:CCGGCCCAATAAACTAGATGTGAATCTCGAGATTCACATCTAGTTTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025134.3-5943s1c1
Sequence:CCGGCGCATTGAACTTCTAAGGAAACTCGAGTTTCCTTAGAAGTTCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025134.3-651s1c1
Sequence:CCGGGCCTTATTTCAGGCCAATGAACTCGAGTTCATTGGCCTGAAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-4805s21c1
Sequence:GTACCGGCCGAGCTCTCTTAGCATATTGCTCGAGCAATATGCTAAGAGAGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025134.4-9219s21c1
Sequence:GTACCGGAGCCTCCTTGACACCTATAATCTCGAGATTATAGGTGTCAAGGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-1510s21c1
Sequence:GTACCGGATGACCTTGATCGGCAGTTTACTCGAGTAAACTGCCGATCAAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-7836s21c1
Sequence:GTACCGGGAACGTGTTCAACTGATTAACCTCGAGGTTAATCAGTTGAACACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-1235s21c1
Sequence:GTACCGGATCACATCCTCAGGGTAATTACTCGAGTAATTACCCTGAGGATGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_025134.4-5579s21c1
Sequence:GTACCGGTGCATACCAGCGTACTAATAACTCGAGTTATTAGTACGCTGGTATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025134.4-11107s21c1
Sequence:CCGGGTGTAAAGTTAAGGGTTATAACTCGAGTTATAACCCTTAACTTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_025134.4-2989s21c1
Sequence:CCGGTTCGTACGTGGACTGATATTACTCGAGTAATATCAGTCCACGTACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_025134.4-2754s21c1
Sequence:CCGGGATCAATCCAGGGACTATAAACTCGAGTTTATAGTCCCTGGATTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-3436s21c1
Sequence:GTACCGGCAATGATGTTGAGACGATTAACTCGAGTTAATCGTCTCAACATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025134.4-2166s21c1
Sequence:GTACCGGCAATCTGAAGAAGAGGTTAAACTCGAGTTTAACCTCTTCTTCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177224
VALIDATED
CHD9 MISSION shRNA Bacterial Glycerol Stock
chromodomain helicase DNA binding protein 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177224.1-10780s1c1
Sequence:CCGGCCTGTGAGATAGCCAAAGTTTCTCGAGAAACTTTGGCTATCTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177224.1-4266s1c1
Sequence:CCGGGCAGTTAAAGTCTACAGATTACTCGAGTAATCTGTAGACTTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177224.1-2487s1c1
Sequence:CCGGCCTGGAGTTATGCTTGATATACTCGAGTATATCAAGCATAACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177224.1-1250s1c1
Sequence:CCGGCGGTCATACAAATCAGGCTTTCTCGAGAAAGCCTGATTTGTATGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177224.1-7245s1c1
Sequence:CCGGGCGTCCTTCTATACCACCAAACTCGAGTTTGGTGGTATAGAAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177224
VALIDATED
CHD9 MISSION shRNA shRNA Plasmid DNA
chromodomain helicase DNA binding protein 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177224.1-10780s1c1
Sequence:CCGGCCTGTGAGATAGCCAAAGTTTCTCGAGAAACTTTGGCTATCTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177224.1-4266s1c1
Sequence:CCGGGCAGTTAAAGTCTACAGATTACTCGAGTAATCTGTAGACTTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177224.1-2487s1c1
Sequence:CCGGCCTGGAGTTATGCTTGATATACTCGAGTATATCAAGCATAACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177224.1-1250s1c1
Sequence:CCGGCGGTCATACAAATCAGGCTTTCTCGAGAAAGCCTGATTTGTATGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177224.1-7245s1c1
Sequence:CCGGGCGTCCTTCTATACCACCAAACTCGAGTTTGGTGGTATAGAAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177224
VALIDATED
CHD9 MISSION shRNA Lentiviral Transduction Particles
chromodomain helicase DNA binding protein 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177224.1-10780s1c1
Sequence:CCGGCCTGTGAGATAGCCAAAGTTTCTCGAGAAACTTTGGCTATCTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177224.1-4266s1c1
Sequence:CCGGGCAGTTAAAGTCTACAGATTACTCGAGTAATCTGTAGACTTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177224.1-2487s1c1
Sequence:CCGGCCTGGAGTTATGCTTGATATACTCGAGTATATCAAGCATAACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177224.1-1250s1c1
Sequence:CCGGCGGTCATACAAATCAGGCTTTCTCGAGAAAGCCTGATTTGTATGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177224.1-7245s1c1
Sequence:CCGGGCGTCCTTCTATACCACCAAACTCGAGTTTGGTGGTATAGAAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks