EMAIL THIS PAGE TO A FRIEND

CHDC2

calponin homology domain containing 2

33 Gene Product Result for
Synonyms: CXorf59
UniProtKB ID: Q8N9S7
Gene ID:
Human(286464) Summary: While this gene is well-supported by transcript data, no functional information on its protein product is currently available. [provided by RefSeq, Dec 2009]
Mouse(100041373) calponin homology domain containing 2
Rat(100362598) calponin homology domain containing 2
naked mole-rat(101715578) calponin homology domain containing 2
domestic guinea pig(100726007) calponin homology domain containing 2
cow(613276) calponin homology domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173695 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173695 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173695 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135741 MISSION® esiRNA esiRNA human CXorf59 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173695 Rosetta Predictions human pricing
XM_001476267 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143957 predicted 315
2 SASI_Hs01_00143959 predicted 1173
3 SASI_Hs01_00143960 predicted 1161
4 SASI_Hs01_00143961 predicted 839
5 SASI_Hs01_00143962 predicted 1171
6 SASI_Hs01_00143963 predicted 480
7 SASI_Hs01_00143964 predicted 346
8 SASI_Hs01_00143965 predicted 1185
9 SASI_Hs02_00368639 predicted 1162
10 SASI_Hs01_00143966 predicted 583
11 SASI_Hs01_00143958 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00387957 predicted 638
2 SASI_Mm02_00387958 predicted 641
3 SASI_Mm02_00387959 predicted 640
4 SASI_Mm02_00387960 predicted 1010
5 SASI_Mm02_00387961 predicted 133
6 SASI_Mm02_00387962 predicted 346
7 SASI_Mm02_00387963 predicted 1260
8 SASI_Mm02_00387964 predicted 1473
9 SASI_Mm02_00387965 predicted 1696
10 SASI_Mm02_00387966 predicted 2130
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173695
CHDC2 MISSION shRNA Bacterial Glycerol Stock
calponin homology domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173695.1-1372s1c1
Sequence:CCGGCCTGAAGAGTATCTGCACAATCTCGAGATTGTGCAGATACTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173695.1-349s1c1
Sequence:CCGGGAACCTGCAAAGGGAAACTTACTCGAGTAAGTTTCCCTTTGCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173695.1-1298s1c1
Sequence:CCGGCAACACAGTTGGGAGCCTATTCTCGAGAATAGGCTCCCAACTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173695.1-1630s1c1
Sequence:CCGGGTCGTGATCTCTTTCTCCCTTCTCGAGAAGGGAGAAAGAGATCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173695.1-430s1c1
Sequence:CCGGGAAGATCATGGGTCTCTGGAACTCGAGTTCCAGAGACCCATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173695.1-586s1c1
Sequence:CCGGCCAGAGACTATAAGAAGGGATCTCGAGATCCCTTCTTATAGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173695.1-1273s1c1
Sequence:CCGGGACCTTTCAGATGGTCTTGTTCTCGAGAACAAGACCATCTGAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173695.1-589s1c1
Sequence:CCGGGAGACTATAAGAAGGGATGTACTCGAGTACATCCCTTCTTATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173695.1-1321s1c1
Sequence:CCGGCCATTCTTGATTGAGTCTCATCTCGAGATGAGACTCAATCAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173695.1-1420s1c1
Sequence:CCGGGAAATTGACTTTGACGTGGAACTCGAGTTCCACGTCAAAGTCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173695
CHDC2 MISSION shRNA shRNA Plasmid DNA
calponin homology domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173695.1-1372s1c1
Sequence:CCGGCCTGAAGAGTATCTGCACAATCTCGAGATTGTGCAGATACTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173695.1-349s1c1
Sequence:CCGGGAACCTGCAAAGGGAAACTTACTCGAGTAAGTTTCCCTTTGCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173695.1-1298s1c1
Sequence:CCGGCAACACAGTTGGGAGCCTATTCTCGAGAATAGGCTCCCAACTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173695.1-1630s1c1
Sequence:CCGGGTCGTGATCTCTTTCTCCCTTCTCGAGAAGGGAGAAAGAGATCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173695.1-430s1c1
Sequence:CCGGGAAGATCATGGGTCTCTGGAACTCGAGTTCCAGAGACCCATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173695.1-586s1c1
Sequence:CCGGCCAGAGACTATAAGAAGGGATCTCGAGATCCCTTCTTATAGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173695.1-1273s1c1
Sequence:CCGGGACCTTTCAGATGGTCTTGTTCTCGAGAACAAGACCATCTGAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173695.1-589s1c1
Sequence:CCGGGAGACTATAAGAAGGGATGTACTCGAGTACATCCCTTCTTATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173695.1-1321s1c1
Sequence:CCGGCCATTCTTGATTGAGTCTCATCTCGAGATGAGACTCAATCAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173695.1-1420s1c1
Sequence:CCGGGAAATTGACTTTGACGTGGAACTCGAGTTCCACGTCAAAGTCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173695
CHDC2 MISSION shRNA Lentiviral Transduction Particles
calponin homology domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173695.1-1372s1c1
Sequence:CCGGCCTGAAGAGTATCTGCACAATCTCGAGATTGTGCAGATACTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173695.1-349s1c1
Sequence:CCGGGAACCTGCAAAGGGAAACTTACTCGAGTAAGTTTCCCTTTGCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173695.1-1298s1c1
Sequence:CCGGCAACACAGTTGGGAGCCTATTCTCGAGAATAGGCTCCCAACTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173695.1-1630s1c1
Sequence:CCGGGTCGTGATCTCTTTCTCCCTTCTCGAGAAGGGAGAAAGAGATCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173695.1-430s1c1
Sequence:CCGGGAAGATCATGGGTCTCTGGAACTCGAGTTCCAGAGACCCATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173695.1-586s1c1
Sequence:CCGGCCAGAGACTATAAGAAGGGATCTCGAGATCCCTTCTTATAGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173695.1-1273s1c1
Sequence:CCGGGACCTTTCAGATGGTCTTGTTCTCGAGAACAAGACCATCTGAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173695.1-589s1c1
Sequence:CCGGGAGACTATAAGAAGGGATGTACTCGAGTACATCCCTTCTTATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173695.1-1321s1c1
Sequence:CCGGCCATTCTTGATTGAGTCTCATCTCGAGATGAGACTCAATCAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173695.1-1420s1c1
Sequence:CCGGGAAATTGACTTTGACGTGGAACTCGAGTTCCACGTCAAAGTCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks