EMAIL THIS PAGE TO A FRIEND

CHDH

choline dehydrogenase

65 Gene Product Result for
UniProtKB ID: Q8NE62, Q9NY17
Gene ID:
Human(55349) Summary: The protein encoded by this gene is a choline dehydrogenase that localizes to the mitochondrion. Variations in this gene can affect susceptibility to choline deficiency. A few transcript variants have been found for this gene, but the full-length nature of only one has been characterized to date. [provided by RefSeq, Dec 2010]
Mouse(218865) choline dehydrogenase
Rat(290551) choline dehydrogenase
Zebrafish(100331020) choline dehydrogenase
Horse(100059455) choline dehydrogenase
chicken(415993) choline dehydrogenase
cow(505218) choline dehydrogenase
domestic cat(101089175) choline dehydrogenase
dog(484723) choline dehydrogenase
domestic guinea pig(100725002) choline dehydrogenase
naked mole-rat(101716121) choline dehydrogenase
sheep(101106116) choline dehydrogenase
Domestic Rabbit(100350567) choline dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018397 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018397 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018397 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172264 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172264 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172264 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121501 MISSION® esiRNA esiRNA human CHDH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018397 Rosetta Predictions human pricing
NM_198731 Rosetta Predictions rat pricing
NM_172264 Rosetta Predictions mouse pricing
NM_175343 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172987 predicted 1540
2 SASI_Hs01_00172988 predicted 1483
3 SASI_Hs01_00172989 predicted 1047
4 SASI_Hs01_00172991 predicted 1552
5 SASI_Hs01_00172992 predicted 300
6 SASI_Hs01_00172993 predicted 967
7 SASI_Hs01_00172994 predicted 1240
8 SASI_Hs01_00172995 predicted 1186
9 SASI_Hs01_00172996 predicted 1556
10 SASI_Hs02_00351888 predicted 1583
11 SASI_Hs01_00172990 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269937 predicted 1885
2 SASI_Rn01_00077726 predicted 444
3 SASI_Rn01_00077727 predicted 1606
4 SASI_Rn01_00077728 predicted 551
5 SASI_Rn01_00077730 predicted 1659
6 SASI_Rn02_00269938 predicted 1287
7 SASI_Rn01_00077731 predicted 755
8 SASI_Rn02_00269939 predicted 1958
9 SASI_Rn01_00077732 predicted 1553
10 SASI_Rn01_00077734 predicted 1035
11 SASI_Rn01_00077725 predicted 2040
12 SASI_Rn01_00077729 predicted 1962
13 SASI_Rn01_00077733 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182410 predicted 1680
2 SASI_Mm01_00182411 predicted 1778
3 SASI_Mm01_00182412 predicted 1420
4 SASI_Mm01_00182413 predicted 1861
5 SASI_Mm02_00343732 predicted 1355
6 SASI_Mm01_00182415 predicted 1433
7 SASI_Mm01_00182416 predicted 2325
8 SASI_Mm01_00182417 predicted 1991
9 SASI_Mm02_00343733 predicted 1287
10 SASI_Mm02_00343734 predicted 1272
11 SASI_Mm01_00182414 predicted 1673
12 SASI_Mm01_00182418 predicted 1373
13 SASI_Mm01_00182419 predicted 2204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145941 predicted 1849
2 SASI_Mm01_00145942 predicted 1950
3 SASI_Mm01_00145943 predicted 1597
4 SASI_Mm01_00145944 predicted 2037
5 SASI_Mm02_00346145 predicted 1532
6 SASI_Mm01_00145946 predicted 1613
7 SASI_Mm01_00145947 predicted 2498
8 SASI_Mm01_00145948 predicted 2164
9 SASI_Mm02_00346146 predicted 1463
10 SASI_Mm02_00346147 predicted 1447
11 SASI_Mm01_00145945 predicted 1841
12 SASI_Mm01_00145949 predicted 1559
13 SASI_Mm01_00145950 predicted 2381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018397
CHDH MISSION shRNA Bacterial Glycerol Stock
choline dehydrogenase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018397.1-878s1c1
Sequence:CCGGTGGATGGACATGACCATCCATCTCGAGATGGATGGTCATGTCCATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018397.1-1547s1c1
Sequence:CCGGCCCAACTACTTGTCAACAGAACTCGAGTTCTGTTGACAAGTAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018397.1-1563s1c1
Sequence:CCGGCAGAAACTGATATTGAGGATTCTCGAGAATCCTCAATATCAGTTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018397.1-1682s1c1
Sequence:CCGGGATAAAGAGATAGATGCCTTTCTCGAGAAAGGCATCTATCTCTTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018397.1-499s1c1
Sequence:CCGGCGACAGGTACAACTGGTGCTACTCGAGTAGCACCAGTTGTACCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018397.3-1580s21c1
Sequence:CCGGTCTGGAAACAGGTGGGTTCATCTCGAGATGAACCCACCTGTTTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018397.3-2677s21c1
Sequence:CCGGAGTAAGTCACACAGTAGTTAGCTCGAGCTAACTACTGTGTGACTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018397
CHDH MISSION shRNA shRNA Plasmid DNA
choline dehydrogenase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018397.1-878s1c1
Sequence:CCGGTGGATGGACATGACCATCCATCTCGAGATGGATGGTCATGTCCATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018397.1-1547s1c1
Sequence:CCGGCCCAACTACTTGTCAACAGAACTCGAGTTCTGTTGACAAGTAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018397.1-1563s1c1
Sequence:CCGGCAGAAACTGATATTGAGGATTCTCGAGAATCCTCAATATCAGTTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018397.1-1682s1c1
Sequence:CCGGGATAAAGAGATAGATGCCTTTCTCGAGAAAGGCATCTATCTCTTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018397.1-499s1c1
Sequence:CCGGCGACAGGTACAACTGGTGCTACTCGAGTAGCACCAGTTGTACCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018397.3-1580s21c1
Sequence:CCGGTCTGGAAACAGGTGGGTTCATCTCGAGATGAACCCACCTGTTTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018397.3-2677s21c1
Sequence:CCGGAGTAAGTCACACAGTAGTTAGCTCGAGCTAACTACTGTGTGACTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018397
CHDH MISSION shRNA Lentiviral Transduction Particles
choline dehydrogenase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018397.1-878s1c1
Sequence:CCGGTGGATGGACATGACCATCCATCTCGAGATGGATGGTCATGTCCATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018397.1-1547s1c1
Sequence:CCGGCCCAACTACTTGTCAACAGAACTCGAGTTCTGTTGACAAGTAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018397.1-1563s1c1
Sequence:CCGGCAGAAACTGATATTGAGGATTCTCGAGAATCCTCAATATCAGTTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018397.1-1682s1c1
Sequence:CCGGGATAAAGAGATAGATGCCTTTCTCGAGAAAGGCATCTATCTCTTTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018397.1-499s1c1
Sequence:CCGGCGACAGGTACAACTGGTGCTACTCGAGTAGCACCAGTTGTACCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018397.3-1580s21c1
Sequence:CCGGTCTGGAAACAGGTGGGTTCATCTCGAGATGAACCCACCTGTTTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018397.3-2677s21c1
Sequence:CCGGAGTAAGTCACACAGTAGTTAGCTCGAGCTAACTACTGTGTGACTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172264
CHDH MISSION shRNA Bacterial Glycerol Stock
choline dehydrogenase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172264.1-376s1c1
Sequence:CCGGCCAACCTGTGTGATGACAAATCTCGAGATTTGTCATCACACAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172264.1-338s1c1
Sequence:CCGGGCTTCAGTGGAAGATCCATATCTCGAGATATGGATCTTCCACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172264.1-1562s1c1
Sequence:CCGGCGTCCAGTCAGACAAAGAGATCTCGAGATCTCTTTGTCTGACTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172264.1-1299s1c1
Sequence:CCGGCCATCGCAAGTGATTGACCATCTCGAGATGGTCAATCACTTGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172264.1-1438s1c1
Sequence:CCGGCCAACTACTTGTCAACAGAAACTCGAGTTTCTGTTGACAAGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172264
CHDH MISSION shRNA shRNA Plasmid DNA
choline dehydrogenase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172264.1-376s1c1
Sequence:CCGGCCAACCTGTGTGATGACAAATCTCGAGATTTGTCATCACACAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172264.1-338s1c1
Sequence:CCGGGCTTCAGTGGAAGATCCATATCTCGAGATATGGATCTTCCACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172264.1-1562s1c1
Sequence:CCGGCGTCCAGTCAGACAAAGAGATCTCGAGATCTCTTTGTCTGACTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172264.1-1299s1c1
Sequence:CCGGCCATCGCAAGTGATTGACCATCTCGAGATGGTCAATCACTTGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172264.1-1438s1c1
Sequence:CCGGCCAACTACTTGTCAACAGAAACTCGAGTTTCTGTTGACAAGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172264
CHDH MISSION shRNA Lentiviral Transduction Particles
choline dehydrogenase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172264.1-376s1c1
Sequence:CCGGCCAACCTGTGTGATGACAAATCTCGAGATTTGTCATCACACAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172264.1-338s1c1
Sequence:CCGGGCTTCAGTGGAAGATCCATATCTCGAGATATGGATCTTCCACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172264.1-1562s1c1
Sequence:CCGGCGTCCAGTCAGACAAAGAGATCTCGAGATCTCTTTGTCTGACTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172264.1-1299s1c1
Sequence:CCGGCCATCGCAAGTGATTGACCATCTCGAGATGGTCAATCACTTGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172264.1-1438s1c1
Sequence:CCGGCCAACTACTTGTCAACAGAAACTCGAGTTTCTGTTGACAAGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks