EMAIL THIS PAGE TO A FRIEND

CHEK1

checkpoint kinase 1

Synonyms: CHK1
Gene ID:
Human(1111) Summary: The protein encoded by this gene belongs to the Ser/Thr protein kinase family. It is required for checkpoint mediated cell cycle arrest in response to DNA damage or the presence of unreplicated DNA. This protein acts to integrate signals from ATM and ATR, two cell cycle proteins involved in DNA damage responses, that also associate with chromatin in meiotic prophase I. Phosphorylation of CDC25A protein phosphatase by this protein is required for cells to delay cell cycle progression in response to double-strand DNA breaks. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(12649) checkpoint kinase 1
Rat(140583) checkpoint kinase 1
Zebrafish(393162) CHK1 checkpoint homolog (S. pombe)
domestic cat(101083365) checkpoint kinase 1
Horse(100064353) checkpoint kinase 1
cow(513678) CHK1 checkpoint homolog (S. pombe)
dog(609767) checkpoint kinase 1
sheep(101111403) checkpoint kinase 1
naked mole-rat(101701035) checkpoint kinase 1
domestic guinea pig(100719613) checkpoint kinase 1
230 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300390 Anti-CHEK1 (Ab-317) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
AV32589 Anti-CHEK1 antibody produced in rabbit affinity isolated antibody human, horse, mouse, guinea pig, zebrafish, bovine, rat, rabbit, canine
immunohistochemistry, western blot pricing
SAB2104134 Anti-CHEK1 antibody produced in rabbit affinity isolated antibody bovine, mouse, rabbit, human, rat, horse, guinea pig
western blot pricing
HPA044364 Anti-CHEK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1300647 Anti-CHK1 (S280) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB4500207 Anti-CHK1 antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4500208 Anti-CHK1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence pricing
SAB4500209 Anti-CHK1 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4500210 Anti-CHK1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4500211 Anti-CHK1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB1302607 ANTI-MOUSE CHEK1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4300116 Anti-phospho-CHEK1 (pSer280) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504363 Anti-phospho-Chk1 (pSer280) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504146 Anti-phospho-Chk1 (pSer286) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301484 Anti-phospho-Chk1 (pSer286) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504025 Anti-phospho-Chk1 (pSer296) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301245 Anti-phospho-Chk1 (pSer296) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4504147 Anti-phospho-Chk1 (pSer301) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301485 Anti-phospho-Chk1 (pSer301) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504364 Anti-phospho-Chk1 (pSer317) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504365 Anti-phospho-Chk1 (pSer345) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
PLA0054 Goat anti-Chk1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rhesus monkey, gorilla, chimpanzee, rabbit, rat, mouse, dog, rabbit, human, horse
proximity ligation assay, western blot pricing
PLA0055 Goat anti-Chk1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, primate, gibbon, dog, chimpanzee, pig, rhesus monkey, gorilla
immunoprecipitation, proximity ligation assay, western blot pricing
WH0001111M5 Monoclonal Anti-CHEK1 antibody produced in mouse clone 2G3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB5300524 Monoclonal Anti-CHEK1 antibody produced in mouse clone 2G1D5, ascites fluid mouse, human
ELISA, western blot pricing
C9358 Monoclonal Anti-Chk1 antibody produced in mouse ~2 mg/mL, clone DCS-310, purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, immunoprecipitation, microarray, western blot pricing
PLA0085 Rabbit anti-Chk1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. primate, human, pig, dog, chimpanzee, gibbon, rhesus monkey, gorilla
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing
PLA0056 Rabbit anti-Phospho Chk1 (S317) Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. pig, gorilla, chimpanzee, primate, human, horse, dog, rabbit, rhesus monkey
proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007691 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007691 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007691 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001274 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056141 MISSION® esiRNA esiRNA human CHEK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114121 Rosetta Predictions human pricing
NM_001114122 Rosetta Predictions human pricing
NM_001274 siRNAs that have been validated in the lab human pricing
NM_080400 Rosetta Predictions rat pricing
NM_007691 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326304 predicted 2074
2 SASI_Hs02_00326305 predicted 1106
3 SASI_Hs02_00326306 predicted 2052
4 SASI_Hs02_00326307 predicted 1260
5 SASI_Hs02_00326308 predicted 1299
6 SASI_Hs02_00326309 predicted 1204
7 SASI_Hs02_00326310 predicted 2119
8 SASI_Hs02_00326311 predicted 2078
9 SASI_Hs02_00326312 predicted 1824
10 SASI_Hs02_00326313 predicted 2045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326314 predicted 2075
2 SASI_Hs02_00326315 predicted 1106
3 SASI_Hs02_00326316 predicted 2056
4 SASI_Hs02_00326317 predicted 1261
5 SASI_Hs02_00326318 predicted 1300
6 SASI_Hs02_00326319 predicted 1200
7 SASI_Hs02_00326320 predicted 2113
8 SASI_Hs02_00326321 predicted 2079
9 SASI_Hs02_00326322 predicted 1824
10 SASI_Hs02_00326323 predicted 2044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001274 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027316 validated 313
2 SASI_Hs01_00027317 predicted 1361
3 SASI_Hs02_00331483 predicted 399
4 SASI_Hs02_00331484 predicted 1338
5 SASI_Hs01_00027321 predicted 544
6 SASI_Hs02_00331485 predicted 580
7 SASI_Hs02_00331486 predicted 483
8 SASI_Hs01_00027323 predicted 1409
9 SASI_Hs02_00331487 predicted 1365
10 SASI_Hs02_00331488 predicted 1108
11 SASI_Hs02_00331489 predicted 1325
12 SASI_Hs01_00027318 predicted 1403
13 SASI_Hs01_00027319 predicted 230
14 SASI_Hs01_00027320 predicted 1645
15 SASI_Hs01_00027322 predicted 1498
16 SASI_Hs01_00027324 predicted 1547
17 SASI_Hs01_00027325 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096403 predicted 1553
2 SASI_Rn01_00096405 predicted 839
3 SASI_Rn01_00096407 predicted 720
4 SASI_Rn01_00096408 predicted 580
5 SASI_Rn01_00096409 predicted 1171
6 SASI_Rn01_00096410 predicted 415
7 SASI_Rn02_00267228 predicted 1210
8 SASI_Rn01_00096411 predicted 539
9 SASI_Rn02_00267229 predicted 1250
10 SASI_Rn01_00096412 predicted 547
11 SASI_Rn01_00096404 predicted 838
12 SASI_Rn01_00096406 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155796 predicted 1309
2 SASI_Mm01_00155797 predicted 1137
3 SASI_Mm01_00155798 predicted 1304
4 SASI_Mm01_00155799 predicted 1600
5 SASI_Mm01_00155800 predicted 269
6 SASI_Mm01_00155801 predicted 1386
7 SASI_Mm01_00155802 predicted 1585
8 SASI_Mm01_00155803 predicted 1522
9 SASI_Mm02_00312232 predicted 1285
10 SASI_Mm01_00155805 predicted 453
11 SASI_Mm01_00155804 predicted 1493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007691
VALIDATED
CHEK1 MISSION shRNA Bacterial Glycerol Stock
checkpoint kinase 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007691.5-1424s21c1
Sequence:CCGGACTGGTTGACTTCCGACTTTCCTCGAGGAAAGTCGGAAGTCAACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007691.5-2040s21c1
Sequence:CCGGACAAGGGCTTGACCAATTATACTCGAGTATAATTGGTCAAGCCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007691.5-689s21c1
Sequence:CCGGGTCCTGTGGAATAGTACTTACCTCGAGGTAAGTACTATTCCACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007691.5-1471s21c1
Sequence:CCGGGACACTTCCTGAAGATTAAAGCTCGAGCTTTAATCTTCAGGAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007691.5-986s21c1
Sequence:CCGGTAAGCACATTCATTCCAATTTCTCGAGAAATTGGAATGAATGTGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007691.5-1258s21c1
Sequence:CCGGCTAAATTGGATGCGGACAAATCTCGAGATTTGTCCGCATCCAATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007691.5-1933s21c1
Sequence:CCGGGAATAAACACAGACCATATACCTCGAGGTATATGGTCTGTGTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007691.2-1814s1c1
Sequence:CCGGCCCATGTAGTAGTATCACTTTCTCGAGAAAGTGATACTACTACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007691.2-537s1c1
Sequence:CCGGGCAACGGTATTTCGGCATAATCTCGAGATTATGCCGAAATACCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007691.2-1292s1c1
Sequence:CCGGGTGGAAGAAGAGTTGTATGAACTCGAGTTCATACAACTCTTCTTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007691.2-159s1c1
Sequence:CCGGGCTGTGAATAGAATAACTGAACTCGAGTTCAGTTATTCTATTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007691.2-271s1c1
Sequence:CCGGGCCACGAGAATGTAGTGAAATCTCGAGATTTCACTACATTCTCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007691
VALIDATED
CHEK1 MISSION shRNA shRNA Plasmid DNA
checkpoint kinase 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007691.5-1424s21c1
Sequence:CCGGACTGGTTGACTTCCGACTTTCCTCGAGGAAAGTCGGAAGTCAACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007691.5-2040s21c1
Sequence:CCGGACAAGGGCTTGACCAATTATACTCGAGTATAATTGGTCAAGCCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007691.5-689s21c1
Sequence:CCGGGTCCTGTGGAATAGTACTTACCTCGAGGTAAGTACTATTCCACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007691.5-1471s21c1
Sequence:CCGGGACACTTCCTGAAGATTAAAGCTCGAGCTTTAATCTTCAGGAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007691.5-986s21c1
Sequence:CCGGTAAGCACATTCATTCCAATTTCTCGAGAAATTGGAATGAATGTGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007691.5-1258s21c1
Sequence:CCGGCTAAATTGGATGCGGACAAATCTCGAGATTTGTCCGCATCCAATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007691.5-1933s21c1
Sequence:CCGGGAATAAACACAGACCATATACCTCGAGGTATATGGTCTGTGTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007691.2-1814s1c1
Sequence:CCGGCCCATGTAGTAGTATCACTTTCTCGAGAAAGTGATACTACTACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007691.2-537s1c1
Sequence:CCGGGCAACGGTATTTCGGCATAATCTCGAGATTATGCCGAAATACCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007691.2-1292s1c1
Sequence:CCGGGTGGAAGAAGAGTTGTATGAACTCGAGTTCATACAACTCTTCTTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007691.2-159s1c1
Sequence:CCGGGCTGTGAATAGAATAACTGAACTCGAGTTCAGTTATTCTATTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007691.2-271s1c1
Sequence:CCGGGCCACGAGAATGTAGTGAAATCTCGAGATTTCACTACATTCTCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007691
VALIDATED
CHEK1 MISSION shRNA Lentiviral Transduction Particles
checkpoint kinase 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007691.5-1424s21c1
Sequence:CCGGACTGGTTGACTTCCGACTTTCCTCGAGGAAAGTCGGAAGTCAACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007691.5-2040s21c1
Sequence:CCGGACAAGGGCTTGACCAATTATACTCGAGTATAATTGGTCAAGCCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007691.5-689s21c1
Sequence:CCGGGTCCTGTGGAATAGTACTTACCTCGAGGTAAGTACTATTCCACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007691.5-1471s21c1
Sequence:CCGGGACACTTCCTGAAGATTAAAGCTCGAGCTTTAATCTTCAGGAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007691.5-986s21c1
Sequence:CCGGTAAGCACATTCATTCCAATTTCTCGAGAAATTGGAATGAATGTGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007691.5-1258s21c1
Sequence:CCGGCTAAATTGGATGCGGACAAATCTCGAGATTTGTCCGCATCCAATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007691.5-1933s21c1
Sequence:CCGGGAATAAACACAGACCATATACCTCGAGGTATATGGTCTGTGTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007691.2-1814s1c1
Sequence:CCGGCCCATGTAGTAGTATCACTTTCTCGAGAAAGTGATACTACTACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007691.2-537s1c1
Sequence:CCGGGCAACGGTATTTCGGCATAATCTCGAGATTATGCCGAAATACCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007691.2-1292s1c1
Sequence:CCGGGTGGAAGAAGAGTTGTATGAACTCGAGTTCATACAACTCTTCTTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007691.2-159s1c1
Sequence:CCGGGCTGTGAATAGAATAACTGAACTCGAGTTCAGTTATTCTATTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007691.2-271s1c1
Sequence:CCGGGCCACGAGAATGTAGTGAAATCTCGAGATTTCACTACATTCTCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001274
VALIDATED
CHEK1 MISSION shRNA Bacterial Glycerol Stock
checkpoint kinase 1
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-1319s1c1
Sequence:CCGGCAAATCTTATCAATGCCTGAACTCGAGTTCAGGCATTGATAAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-1196s1c1
Sequence:CCGGGCCCACATGTCCTGATCATATCTCGAGATATGATCAGGACATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-1378s1c1
Sequence:CCGGGTTGTATGAATCAGGTTACTACTCGAGTAGTAACCTGATTCATACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.x-1065s1c1
Sequence:CCGGGTAAACAGTGCTTCTAGTGAACTCGAGTTCACTAGAAGCACTGTTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.x-438s1c1
Sequence:CCGGGACAGAATAGAGCCAGACATACTCGAGTATGTCTGGCTCTATTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.x-1317s1c1
Sequence:CCGGGACAAATCTTATCAATGCCTGCTCGAGCAGGCATTGATAAGATTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.x-1526s1c1
Sequence:CCGGGAAGATTAAAGGGAAGCTGATCTCGAGATCAGCTTCCCTTTAATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.x-510s1c1
Sequence:CCGGGTGGTTTATCTGCATGGTATTCTCGAGAATACCATGCAGATAAACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.x-234s1c1
Sequence:CCGGGCTGTGAATAGAGTAACTGAACTCGAGTTCAGTTACTCTATTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.x-263s1c1
Sequence:CCGGCGCAGTGAAGATTGTAGATATCTCGAGATATCTACAATCTTCACTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.x-1679s1c1
Sequence:CCGGCTGCAAATAGTAGTTCCTGAACTCGAGTTCAGGAACTACTATTTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001274.x-1609s1c1
Sequence:CCGGAATCCTGGTGAATATAGTGCCTCGAGGCACTATATTCACCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.x-1547s1c1
Sequence:CCGGTGATATTGTGAGCAGCCAGAACTCGAGTTCTGGCTGCTCACAATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.x-285s1c1
Sequence:CCGGAAGCGTGCCGTAGACTGTCCACTCGAGTGGACAGTCTACGGCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-793s1c1
Sequence:CCGGGTGACAGCTGTCAGGAGTATTCTCGAGAATACTCCTGACAGCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-1639s1c1
Sequence:CCGGGACATTATTCTTCCTAGAGAACTCGAGTTCTCTAGGAAGAATAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.2-916s1c1
Sequence:CCGGGAATTACCATTCCAGACATCACTCGAGTGATGTCTGGAATGGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001274.2-382s1c1
Sequence:CCGGGAGAAGGCAATATCCAATATTCTCGAGAATATTGGATATTGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-870s1c1
Sequence:CCGGCCTCTAGCTCTGCTGCATAAACTCGAGTTTATGCAGCAGAGCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-1152s1c1
Sequence:CCGGCCCTCATACATTGATAAATTGCTCGAGCAATTTATCAATGTATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001274
VALIDATED
CHEK1 MISSION shRNA shRNA Plasmid DNA
checkpoint kinase 1
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-1319s1c1
Sequence:CCGGCAAATCTTATCAATGCCTGAACTCGAGTTCAGGCATTGATAAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-1196s1c1
Sequence:CCGGGCCCACATGTCCTGATCATATCTCGAGATATGATCAGGACATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-1378s1c1
Sequence:CCGGGTTGTATGAATCAGGTTACTACTCGAGTAGTAACCTGATTCATACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.x-1065s1c1
Sequence:CCGGGTAAACAGTGCTTCTAGTGAACTCGAGTTCACTAGAAGCACTGTTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.x-438s1c1
Sequence:CCGGGACAGAATAGAGCCAGACATACTCGAGTATGTCTGGCTCTATTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.x-1317s1c1
Sequence:CCGGGACAAATCTTATCAATGCCTGCTCGAGCAGGCATTGATAAGATTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.x-1526s1c1
Sequence:CCGGGAAGATTAAAGGGAAGCTGATCTCGAGATCAGCTTCCCTTTAATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.x-510s1c1
Sequence:CCGGGTGGTTTATCTGCATGGTATTCTCGAGAATACCATGCAGATAAACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.x-234s1c1
Sequence:CCGGGCTGTGAATAGAGTAACTGAACTCGAGTTCAGTTACTCTATTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.x-263s1c1
Sequence:CCGGCGCAGTGAAGATTGTAGATATCTCGAGATATCTACAATCTTCACTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.x-1679s1c1
Sequence:CCGGCTGCAAATAGTAGTTCCTGAACTCGAGTTCAGGAACTACTATTTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001274.x-1609s1c1
Sequence:CCGGAATCCTGGTGAATATAGTGCCTCGAGGCACTATATTCACCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.x-1547s1c1
Sequence:CCGGTGATATTGTGAGCAGCCAGAACTCGAGTTCTGGCTGCTCACAATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.x-285s1c1
Sequence:CCGGAAGCGTGCCGTAGACTGTCCACTCGAGTGGACAGTCTACGGCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-793s1c1
Sequence:CCGGGTGACAGCTGTCAGGAGTATTCTCGAGAATACTCCTGACAGCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-1639s1c1
Sequence:CCGGGACATTATTCTTCCTAGAGAACTCGAGTTCTCTAGGAAGAATAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.2-916s1c1
Sequence:CCGGGAATTACCATTCCAGACATCACTCGAGTGATGTCTGGAATGGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001274.2-382s1c1
Sequence:CCGGGAGAAGGCAATATCCAATATTCTCGAGAATATTGGATATTGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-870s1c1
Sequence:CCGGCCTCTAGCTCTGCTGCATAAACTCGAGTTTATGCAGCAGAGCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-1152s1c1
Sequence:CCGGCCCTCATACATTGATAAATTGCTCGAGCAATTTATCAATGTATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001274
VALIDATED
CHEK1 MISSION shRNA Lentiviral Transduction Particles
checkpoint kinase 1
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-1319s1c1
Sequence:CCGGCAAATCTTATCAATGCCTGAACTCGAGTTCAGGCATTGATAAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-1196s1c1
Sequence:CCGGGCCCACATGTCCTGATCATATCTCGAGATATGATCAGGACATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-1378s1c1
Sequence:CCGGGTTGTATGAATCAGGTTACTACTCGAGTAGTAACCTGATTCATACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.x-1065s1c1
Sequence:CCGGGTAAACAGTGCTTCTAGTGAACTCGAGTTCACTAGAAGCACTGTTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.x-438s1c1
Sequence:CCGGGACAGAATAGAGCCAGACATACTCGAGTATGTCTGGCTCTATTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.x-1317s1c1
Sequence:CCGGGACAAATCTTATCAATGCCTGCTCGAGCAGGCATTGATAAGATTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.x-1526s1c1
Sequence:CCGGGAAGATTAAAGGGAAGCTGATCTCGAGATCAGCTTCCCTTTAATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.x-510s1c1
Sequence:CCGGGTGGTTTATCTGCATGGTATTCTCGAGAATACCATGCAGATAAACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.x-234s1c1
Sequence:CCGGGCTGTGAATAGAGTAACTGAACTCGAGTTCAGTTACTCTATTCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.x-263s1c1
Sequence:CCGGCGCAGTGAAGATTGTAGATATCTCGAGATATCTACAATCTTCACTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.x-1679s1c1
Sequence:CCGGCTGCAAATAGTAGTTCCTGAACTCGAGTTCAGGAACTACTATTTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001274.x-1609s1c1
Sequence:CCGGAATCCTGGTGAATATAGTGCCTCGAGGCACTATATTCACCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.x-1547s1c1
Sequence:CCGGTGATATTGTGAGCAGCCAGAACTCGAGTTCTGGCTGCTCACAATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.x-285s1c1
Sequence:CCGGAAGCGTGCCGTAGACTGTCCACTCGAGTGGACAGTCTACGGCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-793s1c1
Sequence:CCGGGTGACAGCTGTCAGGAGTATTCTCGAGAATACTCCTGACAGCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-1639s1c1
Sequence:CCGGGACATTATTCTTCCTAGAGAACTCGAGTTCTCTAGGAAGAATAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001274.2-916s1c1
Sequence:CCGGGAATTACCATTCCAGACATCACTCGAGTGATGTCTGGAATGGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001274.2-382s1c1
Sequence:CCGGGAGAAGGCAATATCCAATATTCTCGAGAATATTGGATATTGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-870s1c1
Sequence:CCGGCCTCTAGCTCTGCTGCATAAACTCGAGTTTATGCAGCAGAGCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001274.2-1152s1c1
Sequence:CCGGCCCTCATACATTGATAAATTGCTCGAGCAATTTATCAATGTATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks