EMAIL THIS PAGE TO A FRIEND

CHEK2

checkpoint kinase 2

171 Gene Product Result for
Synonyms: CDS1 CHK2 HuCds1 LFS2 PP1425 RAD53 hCds1
Gene ID:
Human(11200) Summary: In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(50883) checkpoint kinase 2
Rat(114212) checkpoint kinase 2
domestic guinea pig(100727440) checkpoint kinase 2
naked mole-rat(101721212) checkpoint kinase 2
sheep(101105532) checkpoint kinase 2
Zebrafish(336998) CHK2 checkpoint homolog (S. pombe)
domestic cat(101085665) checkpoint kinase 2
cow(518897) CHK2 checkpoint homolog (S. pombe)
Horse(100059288) checkpoint kinase 2
dog(486338) checkpoint kinase 2
chicken(768913) checkpoint kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW21552 Anti-CHEK2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1407116 Anti-CHEK2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA001878 Anti-CHEK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV30290 Anti-CHEK2 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2100415 Anti-CHEK2 antibody produced in rabbit affinity isolated antibody human
western blot pricing
C9108 Anti-Chk2 antibody, Mouse monoclonal clone DCS-273, purified from hybridoma cell culture human
immunohistochemistry, microarray, western blot pricing
C9233 Anti-Chk2 antibody, Mouse monoclonal clone DCS-270, purified from hybridoma cell culture human
immunocytochemistry, immunohistochemistry, immunoprecipitation, microarray, western blot pricing
SAB1302453 ANTI-MOUSE CHEK2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4300121 Anti-phospho-CHEK2 (pSer516) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504366 Anti-phospho-Chk2 (pSer516) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4504089 Anti-phospho-Chk2 (pThr383) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, western blot pricing
SAB4301253 Anti-phospho-Chk2 (pThr383) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4503860 Anti-phospho-Chk2 (pThr387) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301433 Anti-phospho-Chk2 (pThr387) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB4504367 Anti-phospho-Chk2 (pThr68) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
WH0011200M1 Monoclonal Anti-CHEK2 antibody produced in mouse clone 4B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404917 Monoclonal Anti-CHEK2 antibody produced in mouse clone 4F10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
PLA0122 Rabbit anti-Chk2 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. primate, gorilla, human, gibbon
immunoprecipitation, proximity ligation assay pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C3742 Chk2 Inhibitor II hydrate ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007194 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007194 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007194 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016681 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016681 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016681 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005735 Rosetta Predictions human pricing
NM_007194 Rosetta Predictions human pricing
NM_145862 Rosetta Predictions human pricing
NM_053677 Rosetta Predictions rat pricing
NM_016681 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066347 predicted 828
2 SASI_Hs01_00066348 predicted 922
3 SASI_Hs01_00066349 predicted 961
4 SASI_Hs02_00305004 predicted 767
5 SASI_Hs01_00066350 predicted 962
6 SASI_Hs01_00066351 predicted 809
7 SASI_Hs01_00066352 predicted 930
8 SASI_Hs01_00066353 predicted 808
9 SASI_Hs01_00066354 predicted 759
10 SASI_Hs01_00066355 predicted 931
11 SASI_Hs01_00066356 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012101 predicted 697
2 SASI_Hs01_00012102 predicted 791
3 SASI_Hs01_00012103 predicted 828
4 SASI_Hs02_00343170 predicted 635
5 SASI_Hs01_00012104 predicted 824
6 SASI_Hs01_00012105 predicted 674
7 SASI_Hs01_00012106 predicted 801
8 SASI_Hs01_00012107 predicted 683
9 SASI_Hs01_00012108 predicted 633
10 SASI_Hs01_00012109 predicted 802
11 SASI_Hs01_00012110 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013930 predicted 693
2 SASI_Hs01_00013931 predicted 790
3 SASI_Hs01_00013932 predicted 831
4 SASI_Hs02_00365390 predicted 638
5 SASI_Hs01_00013933 predicted 833
6 SASI_Hs01_00013934 predicted 674
7 SASI_Hs01_00013935 predicted 803
8 SASI_Hs01_00013936 predicted 679
9 SASI_Hs01_00013937 predicted 631
10 SASI_Hs01_00013938 predicted 806
11 SASI_Hs01_00013939 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053677 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266416 predicted 541
2 SASI_Rn01_00037369 predicted 586
3 SASI_Rn01_00037370 predicted 407
4 SASI_Rn01_00037371 predicted 461
5 SASI_Rn01_00037373 predicted 748
6 SASI_Rn02_00266417 predicted 670
7 SASI_Rn01_00037374 predicted 1185
8 SASI_Rn01_00037376 predicted 739
9 SASI_Rn01_00037377 predicted 515
10 SASI_Rn02_00266418 predicted 1137
11 SASI_Rn01_00037368 predicted 967
12 SASI_Rn01_00037372 predicted 1160
13 SASI_Rn01_00037375 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323322 predicted 1088
2 SASI_Mm02_00323323 predicted 406
3 SASI_Mm02_00323324 predicted 699
4 SASI_Mm02_00323325 predicted 380
5 SASI_Mm02_00323326 predicted 785
6 SASI_Mm02_00323327 predicted 653
7 SASI_Mm02_00323328 predicted 997
8 SASI_Mm02_00323329 predicted 679
9 SASI_Mm02_00323330 predicted 538
10 SASI_Mm02_00323331 predicted 611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007194
VALIDATED
CHEK2 MISSION shRNA Bacterial Glycerol Stock
checkpoint kinase 2
Human
21 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007194.3-1205s1c1
Sequence:CCGGCCTCTCTCATGAGAACCTTATCTCGAGATAAGGTTCTCATGAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007194.3-1708s1c1
Sequence:CCGGCCGTGGTTTGAACACGAAAGACTCGAGTCTTTCGTGTTCAAACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007194.3-575s1c1
Sequence:CCGGCCTTTGTAAATACAGAGCTTGCTCGAGCAAGCTCTGTATTTACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007194.3-919s1c1
Sequence:CCGGCCTTGCATCATCAAGATTAAACTCGAGTTTAATCTTGATGATGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.x-2094s1c1
Sequence:CCGGTACAACTTCATTCCTGAAGTCCTCGAGGACTTCAGGAATGAAGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007194.x-894s1c1
Sequence:CCGGACGATGCCAAACTCCAGCCAGCTCGAGCTGGCTGGAGTTTGGCATCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.x-1597s1c1
Sequence:CCGGAGCTAAATCATCCTTGCATCACTCGAGTGATGCAAGGATGATTTAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_007194.x-2394s1c1
Sequence:CCGGACTCCGTGGTTTGAACACGAACTCGAGTTCGTGTTCAAACCACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.x-1236s1c1
Sequence:CCGGTACATAGAAGATCACAGTGGCCTCGAGGCCACTGTGATCTTCTATGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.x-1488s1c1
Sequence:CCGGTGTAAGAAAGTAGCCATAAAGCTCGAGCTTTATGGCTACTTTCTTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.x-2219s1c1
Sequence:CCGGTCAGGATGAAGACATGAAGAGCTCGAGCTCTTCATGTCTTCATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007194.2-2394s1c1
Sequence:CCGGCTCCGTGGTTTGAACACGAACCTCGAGGTTCGTGTTCAAACCACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007194.2-1299s1c1
Sequence:CCGGCGCCGTCCTTTGAATAACAATCTCGAGATTGTTATTCAAAGGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.2-1071s1c1
Sequence:CCGGGCCAATCTTGAATGTGTGAATCTCGAGATTCACACATTCAAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.2-1560s1c1
Sequence:CCGGGCTCTCAATGTTGAAACAGAACTCGAGTTCTGTTTCAACATTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.2-1797s1c1
Sequence:CCGGCGTGACTTAAAGCCAGAGAATCTCGAGATTCTCTGGCTTTAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007194.3-467s21c1
Sequence:CCGGGAACAGATAAATACCGAACATCTCGAGATGTTCGGTATTTATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007194.3-205s21c1
Sequence:CCGGACGATGCCAAACTCCAGCCAGCTCGAGCTGGCTGGAGTTTGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007194.3-1710s21c1
Sequence:CCGGGTGGTTTGAACACGAAAGAAACTCGAGTTTCTTTCGTGTTCAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007194.3-610s21c1
Sequence:CCGGCGCCGTCCTTTGAATAACAATCTCGAGATTGTTATTCAAAGGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007194.3-1205s21c1
Sequence:CCGGCCTCTCTCATGAGAACCTTATCTCGAGATAAGGTTCTCATGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007194
VALIDATED
CHEK2 MISSION shRNA shRNA Plasmid DNA
checkpoint kinase 2
Human
21 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007194.3-1205s1c1
Sequence:CCGGCCTCTCTCATGAGAACCTTATCTCGAGATAAGGTTCTCATGAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007194.3-1708s1c1
Sequence:CCGGCCGTGGTTTGAACACGAAAGACTCGAGTCTTTCGTGTTCAAACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007194.3-575s1c1
Sequence:CCGGCCTTTGTAAATACAGAGCTTGCTCGAGCAAGCTCTGTATTTACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007194.3-919s1c1
Sequence:CCGGCCTTGCATCATCAAGATTAAACTCGAGTTTAATCTTGATGATGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.x-2094s1c1
Sequence:CCGGTACAACTTCATTCCTGAAGTCCTCGAGGACTTCAGGAATGAAGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007194.x-894s1c1
Sequence:CCGGACGATGCCAAACTCCAGCCAGCTCGAGCTGGCTGGAGTTTGGCATCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.x-1597s1c1
Sequence:CCGGAGCTAAATCATCCTTGCATCACTCGAGTGATGCAAGGATGATTTAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_007194.x-2394s1c1
Sequence:CCGGACTCCGTGGTTTGAACACGAACTCGAGTTCGTGTTCAAACCACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.x-1236s1c1
Sequence:CCGGTACATAGAAGATCACAGTGGCCTCGAGGCCACTGTGATCTTCTATGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.x-1488s1c1
Sequence:CCGGTGTAAGAAAGTAGCCATAAAGCTCGAGCTTTATGGCTACTTTCTTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.x-2219s1c1
Sequence:CCGGTCAGGATGAAGACATGAAGAGCTCGAGCTCTTCATGTCTTCATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007194.2-2394s1c1
Sequence:CCGGCTCCGTGGTTTGAACACGAACCTCGAGGTTCGTGTTCAAACCACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007194.2-1299s1c1
Sequence:CCGGCGCCGTCCTTTGAATAACAATCTCGAGATTGTTATTCAAAGGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.2-1071s1c1
Sequence:CCGGGCCAATCTTGAATGTGTGAATCTCGAGATTCACACATTCAAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.2-1560s1c1
Sequence:CCGGGCTCTCAATGTTGAAACAGAACTCGAGTTCTGTTTCAACATTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.2-1797s1c1
Sequence:CCGGCGTGACTTAAAGCCAGAGAATCTCGAGATTCTCTGGCTTTAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007194.3-467s21c1
Sequence:CCGGGAACAGATAAATACCGAACATCTCGAGATGTTCGGTATTTATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007194.3-205s21c1
Sequence:CCGGACGATGCCAAACTCCAGCCAGCTCGAGCTGGCTGGAGTTTGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007194.3-1710s21c1
Sequence:CCGGGTGGTTTGAACACGAAAGAAACTCGAGTTTCTTTCGTGTTCAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007194.3-610s21c1
Sequence:CCGGCGCCGTCCTTTGAATAACAATCTCGAGATTGTTATTCAAAGGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007194.3-1205s21c1
Sequence:CCGGCCTCTCTCATGAGAACCTTATCTCGAGATAAGGTTCTCATGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007194
VALIDATED
CHEK2 MISSION shRNA Lentiviral Transduction Particles
checkpoint kinase 2
Human
21 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007194.3-1205s1c1
Sequence:CCGGCCTCTCTCATGAGAACCTTATCTCGAGATAAGGTTCTCATGAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007194.3-1708s1c1
Sequence:CCGGCCGTGGTTTGAACACGAAAGACTCGAGTCTTTCGTGTTCAAACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007194.3-575s1c1
Sequence:CCGGCCTTTGTAAATACAGAGCTTGCTCGAGCAAGCTCTGTATTTACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007194.3-919s1c1
Sequence:CCGGCCTTGCATCATCAAGATTAAACTCGAGTTTAATCTTGATGATGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.x-2094s1c1
Sequence:CCGGTACAACTTCATTCCTGAAGTCCTCGAGGACTTCAGGAATGAAGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007194.x-894s1c1
Sequence:CCGGACGATGCCAAACTCCAGCCAGCTCGAGCTGGCTGGAGTTTGGCATCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.x-1597s1c1
Sequence:CCGGAGCTAAATCATCCTTGCATCACTCGAGTGATGCAAGGATGATTTAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_007194.x-2394s1c1
Sequence:CCGGACTCCGTGGTTTGAACACGAACTCGAGTTCGTGTTCAAACCACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.x-1236s1c1
Sequence:CCGGTACATAGAAGATCACAGTGGCCTCGAGGCCACTGTGATCTTCTATGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.x-1488s1c1
Sequence:CCGGTGTAAGAAAGTAGCCATAAAGCTCGAGCTTTATGGCTACTTTCTTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.x-2219s1c1
Sequence:CCGGTCAGGATGAAGACATGAAGAGCTCGAGCTCTTCATGTCTTCATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007194.2-2394s1c1
Sequence:CCGGCTCCGTGGTTTGAACACGAACCTCGAGGTTCGTGTTCAAACCACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007194.2-1299s1c1
Sequence:CCGGCGCCGTCCTTTGAATAACAATCTCGAGATTGTTATTCAAAGGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.2-1071s1c1
Sequence:CCGGGCCAATCTTGAATGTGTGAATCTCGAGATTCACACATTCAAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.2-1560s1c1
Sequence:CCGGGCTCTCAATGTTGAAACAGAACTCGAGTTCTGTTTCAACATTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007194.2-1797s1c1
Sequence:CCGGCGTGACTTAAAGCCAGAGAATCTCGAGATTCTCTGGCTTTAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007194.3-467s21c1
Sequence:CCGGGAACAGATAAATACCGAACATCTCGAGATGTTCGGTATTTATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007194.3-205s21c1
Sequence:CCGGACGATGCCAAACTCCAGCCAGCTCGAGCTGGCTGGAGTTTGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007194.3-1710s21c1
Sequence:CCGGGTGGTTTGAACACGAAAGAAACTCGAGTTTCTTTCGTGTTCAAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007194.3-610s21c1
Sequence:CCGGCGCCGTCCTTTGAATAACAATCTCGAGATTGTTATTCAAAGGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007194.3-1205s21c1
Sequence:CCGGCCTCTCTCATGAGAACCTTATCTCGAGATAAGGTTCTCATGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016681
VALIDATED
CHEK2 MISSION shRNA Bacterial Glycerol Stock
checkpoint kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016681.2-1006s1c1
Sequence:CCGGCCTGAAAGAAGCCACCTGTAACTCGAGTTACAGGTGGCTTCTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016681.2-555s1c1
Sequence:CCGGCCTTCGTAAATACCGAGCTTACTCGAGTAAGCTCGGTATTTACGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016681.2-854s1c1
Sequence:CCGGCCCAGTGTGGAAACTGAAATACTCGAGTATTTCAGTTTCCACACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016681.2-1975s1c1
Sequence:CCGGCCATCACAGATACACGATTAACTCGAGTTAATCGTGTATCTGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016681.3-1077s21c1
Sequence:CCGGGATCATACATCGGGACTTAAACTCGAGTTTAAGTCCCGATGTATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016681.3-853s21c1
Sequence:CCGGCCCAGTGTGGAAACTGAAATACTCGAGTATTTCAGTTTCCACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016681.3-554s21c1
Sequence:CCGGCCTTCGTAAATACCGAGCTTACTCGAGTAAGCTCGGTATTTACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016681.3-1005s21c1
Sequence:CCGGCCTGAAAGAAGCCACCTGTAACTCGAGTTACAGGTGGCTTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016681.3-1974s21c1
Sequence:CCGGCCATCACAGATACACGATTAACTCGAGTTAATCGTGTATCTGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016681
VALIDATED
CHEK2 MISSION shRNA shRNA Plasmid DNA
checkpoint kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016681.2-1006s1c1
Sequence:CCGGCCTGAAAGAAGCCACCTGTAACTCGAGTTACAGGTGGCTTCTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016681.2-555s1c1
Sequence:CCGGCCTTCGTAAATACCGAGCTTACTCGAGTAAGCTCGGTATTTACGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016681.2-854s1c1
Sequence:CCGGCCCAGTGTGGAAACTGAAATACTCGAGTATTTCAGTTTCCACACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016681.2-1975s1c1
Sequence:CCGGCCATCACAGATACACGATTAACTCGAGTTAATCGTGTATCTGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016681.3-1077s21c1
Sequence:CCGGGATCATACATCGGGACTTAAACTCGAGTTTAAGTCCCGATGTATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016681.3-853s21c1
Sequence:CCGGCCCAGTGTGGAAACTGAAATACTCGAGTATTTCAGTTTCCACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016681.3-554s21c1
Sequence:CCGGCCTTCGTAAATACCGAGCTTACTCGAGTAAGCTCGGTATTTACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016681.3-1005s21c1
Sequence:CCGGCCTGAAAGAAGCCACCTGTAACTCGAGTTACAGGTGGCTTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016681.3-1974s21c1
Sequence:CCGGCCATCACAGATACACGATTAACTCGAGTTAATCGTGTATCTGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016681
VALIDATED
CHEK2 MISSION shRNA Lentiviral Transduction Particles
checkpoint kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016681.2-1006s1c1
Sequence:CCGGCCTGAAAGAAGCCACCTGTAACTCGAGTTACAGGTGGCTTCTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016681.2-555s1c1
Sequence:CCGGCCTTCGTAAATACCGAGCTTACTCGAGTAAGCTCGGTATTTACGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016681.2-854s1c1
Sequence:CCGGCCCAGTGTGGAAACTGAAATACTCGAGTATTTCAGTTTCCACACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016681.2-1975s1c1
Sequence:CCGGCCATCACAGATACACGATTAACTCGAGTTAATCGTGTATCTGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016681.3-1077s21c1
Sequence:CCGGGATCATACATCGGGACTTAAACTCGAGTTTAAGTCCCGATGTATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016681.3-853s21c1
Sequence:CCGGCCCAGTGTGGAAACTGAAATACTCGAGTATTTCAGTTTCCACACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016681.3-554s21c1
Sequence:CCGGCCTTCGTAAATACCGAGCTTACTCGAGTAAGCTCGGTATTTACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016681.3-1005s21c1
Sequence:CCGGCCTGAAAGAAGCCACCTGTAACTCGAGTTACAGGTGGCTTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016681.3-1974s21c1
Sequence:CCGGCCATCACAGATACACGATTAACTCGAGTTAATCGTGTATCTGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks