EMAIL THIS PAGE TO A FRIEND

CHERP

calcium homeostasis endoplasmic reticulum protein

61 Gene Product Result for
Synonyms: DAN16 SCAF6 SRA1
UniProtKB ID: Q8IWX8, O00302, Q4G0Y5, Q8WU30, Q99492
Gene ID:
Mouse(27967) calcium homeostasis endoplasmic reticulum protein
Rat(290614) calcium homeostasis endoplasmic reticulum protein
Zebrafish(337851) calcium homeostasis endoplasmic reticulum protein
chicken(420144) calcium homeostasis endoplasmic reticulum protein
cow(525110) calcium homeostasis endoplasmic reticulum protein
Horse(100069492) calcium homeostasis endoplasmic reticulum protein
domestic cat(101094405) calcium homeostasis endoplasmic reticulum protein
dog(610237) calcium homeostasis endoplasmic reticulum protein
sheep(101117160) calcium homeostasis endoplasmic reticulum protein
naked mole-rat(101700309) calcium homeostasis endoplasmic reticulum protein
domestic guinea pig(100730254) calcium homeostasis endoplasmic reticulum protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006387 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138585 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138585 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138585 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU070671 MISSION® esiRNA esiRNA targeting mouse Cherp (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006387 Rosetta Predictions human pricing
NM_001106064 Rosetta Predictions rat pricing
NM_138585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223553 predicted 708
2 SASI_Hs01_00223554 predicted 1852
3 SASI_Hs01_00223555 predicted 2702
4 SASI_Hs01_00223556 predicted 3289
5 SASI_Hs01_00223557 predicted 606
6 SASI_Hs01_00223558 predicted 2537
7 SASI_Hs01_00223559 predicted 794
8 SASI_Hs01_00223560 predicted 3111
9 SASI_Hs01_00223561 predicted 813
10 SASI_Hs01_00223562 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215272 predicted 2882
2 SASI_Rn02_00215273 predicted 195
3 SASI_Rn02_00215274 predicted 1629
4 SASI_Rn02_00215275 predicted 2853
5 SASI_Rn02_00215276 predicted 2292
6 SASI_Rn02_00215277 predicted 2862
7 SASI_Rn02_00215278 predicted 866
8 SASI_Rn02_00215279 predicted 2298
9 SASI_Rn02_00215280 predicted 2870
10 SASI_Rn02_00215281 predicted 1571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055262 predicted 292
2 SASI_Mm01_00055263 predicted 2905
3 SASI_Mm01_00055264 predicted 1641
4 SASI_Mm02_00339639 predicted 267
5 SASI_Mm01_00055266 predicted 682
6 SASI_Mm02_00339640 predicted 203
7 SASI_Mm01_00055267 predicted 868
8 SASI_Mm01_00055268 predicted 2103
9 SASI_Mm02_00339641 predicted 875
10 SASI_Mm01_00055269 predicted 1635
11 SASI_Mm01_00055265 predicted 2775
12 SASI_Mm01_00055270 predicted 503
13 SASI_Mm01_00055271 predicted 2682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006387
VALIDATED
CHERP MISSION shRNA Bacterial Glycerol Stock
calcium homeostasis endoplasmic reticulum protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006387.5-2541s21c1
Sequence:CCGGTCTGCTGGTCTGGGTTCTAATCTCGAGATTAGAACCCAGACCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006387.5-2905s21c1
Sequence:CCGGCAGTGACAGCTCAGTTCTTACCTCGAGGTAAGAACTGAGCTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006387.5-159s21c1
Sequence:CCGGGAGTTTGAGAAGATGACTATGCTCGAGCATAGTCATCTTCTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006387.5-2054s21c1
Sequence:CCGGGCTGGAAGATCACGAGTACAACTCGAGTTGTACTCGTGATCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006387.5-218s21c1
Sequence:CCGGCGGAGGCGAATTCTACAGTTACTCGAGTAACTGTAGAATTCGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006387.4-509s1c1
Sequence:CCGGCCAGCTAGACATGAACGAGTTCTCGAGAACTCGTTCATGTCTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006387.4-2039s1c1
Sequence:CCGGGCTGGAAGATCACGAGTACAACTCGAGTTGTACTCGTGATCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006387.4-695s1c1
Sequence:CCGGGCACCTCATCTACCTGATCAACTCGAGTTGATCAGGTAGATGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006387.4-2687s1c1
Sequence:CCGGCCGGGATAAGTGGGACCAGTACTCGAGTACTGGTCCCACTTATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006387.4-203s1c1
Sequence:CCGGCGGAGGCGAATTCTACAGTTACTCGAGTAACTGTAGAATTCGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006387
VALIDATED
CHERP MISSION shRNA shRNA Plasmid DNA
calcium homeostasis endoplasmic reticulum protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006387.5-2541s21c1
Sequence:CCGGTCTGCTGGTCTGGGTTCTAATCTCGAGATTAGAACCCAGACCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006387.5-2905s21c1
Sequence:CCGGCAGTGACAGCTCAGTTCTTACCTCGAGGTAAGAACTGAGCTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006387.5-159s21c1
Sequence:CCGGGAGTTTGAGAAGATGACTATGCTCGAGCATAGTCATCTTCTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006387.5-2054s21c1
Sequence:CCGGGCTGGAAGATCACGAGTACAACTCGAGTTGTACTCGTGATCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006387.5-218s21c1
Sequence:CCGGCGGAGGCGAATTCTACAGTTACTCGAGTAACTGTAGAATTCGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006387.4-509s1c1
Sequence:CCGGCCAGCTAGACATGAACGAGTTCTCGAGAACTCGTTCATGTCTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006387.4-2039s1c1
Sequence:CCGGGCTGGAAGATCACGAGTACAACTCGAGTTGTACTCGTGATCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006387.4-695s1c1
Sequence:CCGGGCACCTCATCTACCTGATCAACTCGAGTTGATCAGGTAGATGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006387.4-2687s1c1
Sequence:CCGGCCGGGATAAGTGGGACCAGTACTCGAGTACTGGTCCCACTTATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006387.4-203s1c1
Sequence:CCGGCGGAGGCGAATTCTACAGTTACTCGAGTAACTGTAGAATTCGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006387
VALIDATED
CHERP MISSION shRNA Lentiviral Transduction Particles
calcium homeostasis endoplasmic reticulum protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006387.5-2541s21c1
Sequence:CCGGTCTGCTGGTCTGGGTTCTAATCTCGAGATTAGAACCCAGACCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006387.5-2905s21c1
Sequence:CCGGCAGTGACAGCTCAGTTCTTACCTCGAGGTAAGAACTGAGCTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006387.5-159s21c1
Sequence:CCGGGAGTTTGAGAAGATGACTATGCTCGAGCATAGTCATCTTCTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006387.5-2054s21c1
Sequence:CCGGGCTGGAAGATCACGAGTACAACTCGAGTTGTACTCGTGATCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006387.5-218s21c1
Sequence:CCGGCGGAGGCGAATTCTACAGTTACTCGAGTAACTGTAGAATTCGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006387.4-509s1c1
Sequence:CCGGCCAGCTAGACATGAACGAGTTCTCGAGAACTCGTTCATGTCTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006387.4-2039s1c1
Sequence:CCGGGCTGGAAGATCACGAGTACAACTCGAGTTGTACTCGTGATCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006387.4-695s1c1
Sequence:CCGGGCACCTCATCTACCTGATCAACTCGAGTTGATCAGGTAGATGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006387.4-2687s1c1
Sequence:CCGGCCGGGATAAGTGGGACCAGTACTCGAGTACTGGTCCCACTTATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006387.4-203s1c1
Sequence:CCGGCGGAGGCGAATTCTACAGTTACTCGAGTAACTGTAGAATTCGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138585
VALIDATED
CHERP MISSION shRNA Bacterial Glycerol Stock
calcium homeostasis endoplasmic reticulum protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138585.3-2778s21c1
Sequence:CCGGAGGGCATTCAGGATCCCATTACTCGAGTAATGGGATCCTGAATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138585.3-185s21c1
Sequence:CCGGCTTCGAAATGTCATCGATAAGCTCGAGCTTATCGATGACATTTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138585.3-1634s21c1
Sequence:CCGGCCCAATTGGAATAACCAGTTTCTCGAGAAACTGGTTATTCCAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138585.3-274s21c1
Sequence:CCGGCCCTAAGTTCTCGTTTCTGTTCTCGAGAACAGAAACGAGAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138585.3-3274s21c1
Sequence:CCGGCCTGACTCAGTTCATCAGTTACTCGAGTAACTGATGAACTGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138585.2-2708s1c1
Sequence:CCGGCCGGGATAAATGGGACCAGTACTCGAGTACTGGTCCCATTTATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138585.2-3170s1c1
Sequence:CCGGCCTGACTCAGTTCATCAGTTACTCGAGTAACTGATGAACTGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138585.2-177s1c1
Sequence:CCGGCCTAAGTTCTCGTTTCTGTTTCTCGAGAAACAGAAACGAGAACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138585.2-1536s1c1
Sequence:CCGGCCCAATTGGAATAACCAGTTTCTCGAGAAACTGGTTATTCCAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138585.2-176s1c1
Sequence:CCGGCCCTAAGTTCTCGTTTCTGTTCTCGAGAACAGAAACGAGAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138585
VALIDATED
CHERP MISSION shRNA shRNA Plasmid DNA
calcium homeostasis endoplasmic reticulum protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138585.3-2778s21c1
Sequence:CCGGAGGGCATTCAGGATCCCATTACTCGAGTAATGGGATCCTGAATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138585.3-185s21c1
Sequence:CCGGCTTCGAAATGTCATCGATAAGCTCGAGCTTATCGATGACATTTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138585.3-1634s21c1
Sequence:CCGGCCCAATTGGAATAACCAGTTTCTCGAGAAACTGGTTATTCCAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138585.3-274s21c1
Sequence:CCGGCCCTAAGTTCTCGTTTCTGTTCTCGAGAACAGAAACGAGAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138585.3-3274s21c1
Sequence:CCGGCCTGACTCAGTTCATCAGTTACTCGAGTAACTGATGAACTGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138585.2-2708s1c1
Sequence:CCGGCCGGGATAAATGGGACCAGTACTCGAGTACTGGTCCCATTTATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138585.2-3170s1c1
Sequence:CCGGCCTGACTCAGTTCATCAGTTACTCGAGTAACTGATGAACTGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138585.2-177s1c1
Sequence:CCGGCCTAAGTTCTCGTTTCTGTTTCTCGAGAAACAGAAACGAGAACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138585.2-1536s1c1
Sequence:CCGGCCCAATTGGAATAACCAGTTTCTCGAGAAACTGGTTATTCCAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138585.2-176s1c1
Sequence:CCGGCCCTAAGTTCTCGTTTCTGTTCTCGAGAACAGAAACGAGAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138585
VALIDATED
CHERP MISSION shRNA Lentiviral Transduction Particles
calcium homeostasis endoplasmic reticulum protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138585.3-2778s21c1
Sequence:CCGGAGGGCATTCAGGATCCCATTACTCGAGTAATGGGATCCTGAATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138585.3-185s21c1
Sequence:CCGGCTTCGAAATGTCATCGATAAGCTCGAGCTTATCGATGACATTTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138585.3-1634s21c1
Sequence:CCGGCCCAATTGGAATAACCAGTTTCTCGAGAAACTGGTTATTCCAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138585.3-274s21c1
Sequence:CCGGCCCTAAGTTCTCGTTTCTGTTCTCGAGAACAGAAACGAGAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138585.3-3274s21c1
Sequence:CCGGCCTGACTCAGTTCATCAGTTACTCGAGTAACTGATGAACTGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138585.2-2708s1c1
Sequence:CCGGCCGGGATAAATGGGACCAGTACTCGAGTACTGGTCCCATTTATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138585.2-3170s1c1
Sequence:CCGGCCTGACTCAGTTCATCAGTTACTCGAGTAACTGATGAACTGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138585.2-177s1c1
Sequence:CCGGCCTAAGTTCTCGTTTCTGTTTCTCGAGAAACAGAAACGAGAACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138585.2-1536s1c1
Sequence:CCGGCCCAATTGGAATAACCAGTTTCTCGAGAAACTGGTTATTCCAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138585.2-176s1c1
Sequence:CCGGCCCTAAGTTCTCGTTTCTGTTCTCGAGAACAGAAACGAGAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks