EMAIL THIS PAGE TO A FRIEND

CHFR

checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase

86 Gene Product Result for
Synonyms: RNF116 RNF196
Gene ID:
Mouse(231600) checkpoint with forkhead and ring finger domains
Rat(288734) checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
Zebrafish(564271) checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
cow(614816) checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
Horse(100061394) checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
domestic cat(101096172) checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
chicken(416792) checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
dog(477434) checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
domestic guinea pig(100725607) checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
naked mole-rat(101722853) checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
sheep(101111490) checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
Domestic Rabbit(100355591) checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172717 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172717 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172717 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018223 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090571 MISSION® esiRNA esiRNA human CHFR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018223 Rosetta Predictions human pricing
NM_001009258 Rosetta Predictions rat pricing
NM_172717 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201617 predicted 228
2 SASI_Hs01_00201618 predicted 1624
3 SASI_Hs01_00201619 predicted 1067
4 SASI_Hs01_00201620 predicted 1177
5 SASI_Hs01_00201621 predicted 1848
6 SASI_Hs01_00201623 predicted 1614
7 SASI_Hs02_00351534 predicted 221
8 SASI_Hs01_00201624 predicted 1892
9 SASI_Hs01_00201625 predicted 903
10 SASI_Hs02_00351535 predicted 1628
11 SASI_Hs01_00201622 predicted 1868
12 SASI_Hs01_00201626 predicted 1223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056354 predicted 346
2 SASI_Rn01_00056355 predicted 1460
3 SASI_Rn01_00056356 predicted 447
4 SASI_Rn01_00056357 predicted 1287
5 SASI_Rn01_00056358 predicted 449
6 SASI_Rn01_00056359 predicted 1679
7 SASI_Rn01_00056360 predicted 421
8 SASI_Rn01_00056361 predicted 299
9 SASI_Rn01_00056362 predicted 573
10 SASI_Rn01_00056363 predicted 1719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172717 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087037 predicted 406
2 SASI_Mm01_00087036 predicted 1184
3 SASI_Mm01_00087038 predicted 1349
4 SASI_Mm02_00344510 predicted 377
5 SASI_Mm01_00087040 predicted 430
6 SASI_Mm02_00344511 predicted 1942
7 SASI_Mm01_00087042 predicted 1224
8 SASI_Mm01_00087043 predicted 2066
9 SASI_Mm01_00087044 predicted 2041
10 SASI_Mm01_00087045 predicted 283
11 SASI_Mm01_00087039 predicted 483
12 SASI_Mm01_00087041 predicted 1291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172717
VALIDATED
CHFR MISSION shRNA Bacterial Glycerol Stock
checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172717.1-319s1c1
Sequence:CCGGCAGCACCAATGGAACAGTGATCTCGAGATCACTGTTCCATTGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172717.1-324s1c1
Sequence:CCGGCCAATGGAACAGTGATCAATACTCGAGTATTGATCACTGTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172717.1-740s1c1
Sequence:CCGGCGCAGTTCACTTGTTGCAAATCTCGAGATTTGCAACAAGTGAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172717.1-1751s1c1
Sequence:CCGGGAATCGGACATCCTGAAGAATCTCGAGATTCTTCAGGATGTCCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172717.1-2916s1c1
Sequence:CCGGGCCATGTCATCTGGAATAATACTCGAGTATTATTCCAGATGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172717
VALIDATED
CHFR MISSION shRNA shRNA Plasmid DNA
checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172717.1-319s1c1
Sequence:CCGGCAGCACCAATGGAACAGTGATCTCGAGATCACTGTTCCATTGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172717.1-324s1c1
Sequence:CCGGCCAATGGAACAGTGATCAATACTCGAGTATTGATCACTGTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172717.1-740s1c1
Sequence:CCGGCGCAGTTCACTTGTTGCAAATCTCGAGATTTGCAACAAGTGAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172717.1-1751s1c1
Sequence:CCGGGAATCGGACATCCTGAAGAATCTCGAGATTCTTCAGGATGTCCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172717.1-2916s1c1
Sequence:CCGGGCCATGTCATCTGGAATAATACTCGAGTATTATTCCAGATGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172717
VALIDATED
CHFR MISSION shRNA Lentiviral Transduction Particles
checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172717.1-319s1c1
Sequence:CCGGCAGCACCAATGGAACAGTGATCTCGAGATCACTGTTCCATTGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172717.1-324s1c1
Sequence:CCGGCCAATGGAACAGTGATCAATACTCGAGTATTGATCACTGTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172717.1-740s1c1
Sequence:CCGGCGCAGTTCACTTGTTGCAAATCTCGAGATTTGCAACAAGTGAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172717.1-1751s1c1
Sequence:CCGGGAATCGGACATCCTGAAGAATCTCGAGATTCTTCAGGATGTCCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172717.1-2916s1c1
Sequence:CCGGGCCATGTCATCTGGAATAATACTCGAGTATTATTCCAGATGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018223
VALIDATED
CHFR MISSION shRNA Bacterial Glycerol Stock
checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018223.1-1053s1c1
Sequence:CCGGGCAGTGAAGAAGATGTGCAAACTCGAGTTTGCACATCTTCTTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018223.1-413s1c1
Sequence:CCGGGCATACCTCTATGAATCTTTACTCGAGTAAAGATTCATAGAGGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018223.1-1483s1c1
Sequence:CCGGGCAGCCTTTCTGCCACCTGTACTCGAGTACAGGTGGCAGAAAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018223.1-2974s1c1
Sequence:CCGGCCTGTTATCCTTGTTTGTAAACTCGAGTTTACAAACAAGGATAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018223.1-1888s1c1
Sequence:CCGGCGCCATGAAATTCAATCATATCTCGAGATATGATTGAATTTCATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-1832s21c1
Sequence:CCGGAGTTGCCAGTGGCCGTAACATCTCGAGATGTTACGGCCACTGGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018223.2-2272s21c1
Sequence:CCGGTTTCCGAAACTACAGTTAAAGCTCGAGCTTTAACTGTAGTTTCGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-356s21c1
Sequence:CCGGAGAAGCAGACATGCCCTTTACCTCGAGGTAAAGGGCATGTCTGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-860s21c1
Sequence:CCGGAGACGCTGACATGCATCATCTCTCGAGAGATGATGCATGTCAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-1790s21c1
Sequence:CCGGGTGAGCTGACCTATCAGTATCCTCGAGGATACTGATAGGTCAGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-781s21c1
Sequence:CCGGGTCGCACAACCGCGTAGAAATCTCGAGATTTCTACGCGGTTGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-1362s21c1
Sequence:CCGGGACGACAGCAGTCCAGGATTACTCGAGTAATCCTGGACTGCTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018223
VALIDATED
CHFR MISSION shRNA shRNA Plasmid DNA
checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018223.1-1053s1c1
Sequence:CCGGGCAGTGAAGAAGATGTGCAAACTCGAGTTTGCACATCTTCTTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018223.1-413s1c1
Sequence:CCGGGCATACCTCTATGAATCTTTACTCGAGTAAAGATTCATAGAGGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018223.1-1483s1c1
Sequence:CCGGGCAGCCTTTCTGCCACCTGTACTCGAGTACAGGTGGCAGAAAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018223.1-2974s1c1
Sequence:CCGGCCTGTTATCCTTGTTTGTAAACTCGAGTTTACAAACAAGGATAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018223.1-1888s1c1
Sequence:CCGGCGCCATGAAATTCAATCATATCTCGAGATATGATTGAATTTCATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-1832s21c1
Sequence:CCGGAGTTGCCAGTGGCCGTAACATCTCGAGATGTTACGGCCACTGGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018223.2-2272s21c1
Sequence:CCGGTTTCCGAAACTACAGTTAAAGCTCGAGCTTTAACTGTAGTTTCGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-356s21c1
Sequence:CCGGAGAAGCAGACATGCCCTTTACCTCGAGGTAAAGGGCATGTCTGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-860s21c1
Sequence:CCGGAGACGCTGACATGCATCATCTCTCGAGAGATGATGCATGTCAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-1790s21c1
Sequence:CCGGGTGAGCTGACCTATCAGTATCCTCGAGGATACTGATAGGTCAGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-781s21c1
Sequence:CCGGGTCGCACAACCGCGTAGAAATCTCGAGATTTCTACGCGGTTGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-1362s21c1
Sequence:CCGGGACGACAGCAGTCCAGGATTACTCGAGTAATCCTGGACTGCTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018223
VALIDATED
CHFR MISSION shRNA Lentiviral Transduction Particles
checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018223.1-1053s1c1
Sequence:CCGGGCAGTGAAGAAGATGTGCAAACTCGAGTTTGCACATCTTCTTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018223.1-413s1c1
Sequence:CCGGGCATACCTCTATGAATCTTTACTCGAGTAAAGATTCATAGAGGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018223.1-1483s1c1
Sequence:CCGGGCAGCCTTTCTGCCACCTGTACTCGAGTACAGGTGGCAGAAAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018223.1-2974s1c1
Sequence:CCGGCCTGTTATCCTTGTTTGTAAACTCGAGTTTACAAACAAGGATAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018223.1-1888s1c1
Sequence:CCGGCGCCATGAAATTCAATCATATCTCGAGATATGATTGAATTTCATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-1832s21c1
Sequence:CCGGAGTTGCCAGTGGCCGTAACATCTCGAGATGTTACGGCCACTGGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018223.2-2272s21c1
Sequence:CCGGTTTCCGAAACTACAGTTAAAGCTCGAGCTTTAACTGTAGTTTCGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-356s21c1
Sequence:CCGGAGAAGCAGACATGCCCTTTACCTCGAGGTAAAGGGCATGTCTGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-860s21c1
Sequence:CCGGAGACGCTGACATGCATCATCTCTCGAGAGATGATGCATGTCAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-1790s21c1
Sequence:CCGGGTGAGCTGACCTATCAGTATCCTCGAGGATACTGATAGGTCAGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-781s21c1
Sequence:CCGGGTCGCACAACCGCGTAGAAATCTCGAGATTTCTACGCGGTTGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018223.2-1362s21c1
Sequence:CCGGGACGACAGCAGTCCAGGATTACTCGAGTAATCCTGGACTGCTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks