EMAIL THIS PAGE TO A FRIEND

CHGA

chromogranin A (parathyroid secretory protein 1)

127 Gene Product Result for
Synonyms: CGA
Gene ID:
Human(1113) Summary: The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. It is found in secretory vesicles of neurons and endocrine cells. This gene product is a precursor to three biologically active peptides; vasostatin, pancreastatin, and parastatin. These peptides act as autocrine or paracrine negative modulators of the neuroendocrine system. Other peptides, including chromostatin, beta-granin, WE-14 and GE-25, are also derived from the full-length protein. However, biological activities for these molecules have not been shown. [provided by RefSeq, Jul 2008]
Mouse(12652) chromogranin A
Rat(24258) chromogranin A (parathyroid secretory protein 1)
sheep(101114907) chromogranin A (parathyroid secretory protein 1)
naked mole-rat(101700108) chromogranin A (parathyroid secretory protein 1)
domestic guinea pig(100717887) chromogranin A (parathyroid secretory protein 1)
Zebrafish(450039) chromogranin A
dog(607527) chromogranin A (parathyroid secretory protein 1)
chicken(423420) chromogranin A (parathyroid secretory protein 1)
Horse(100033828) chromogranin A (parathyroid secretory protein 1)
cow(281070) chromogranin A (parathyroid secretory protein 1)
domestic cat(101087412) chromogranin A (parathyroid secretory protein 1)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108562 Anti-CHGA affinity isolated antibody guinea pig, human, rat, horse, rabbit, mouse, bovine, human
western blot pricing
AV41931 Anti-CHGA (AB1) antibody produced in rabbit affinity isolated antibody horse, rat, rabbit, pig, guinea pig, mouse, bovine, human
western blot pricing
AV41930 Anti-CHGA (AB2) antibody produced in rabbit IgG fraction of antiserum human, canine, mouse, rat, bovine, horse, pig
western blot pricing
HPA017369 Anti-CHGA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4200668 Anti-Chromogranin A antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB5500082 Anti-Chromogranin A antibody, Rabbit monoclonal clone SP12, recombinant, expressed in proprietary host, tissue culture supernatant human (tested)
immunohistochemistry pricing
SAB2500240 Anti-Chromogranin A Precursor antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB4200728 Anti-Chromogranin-A antibody, Mouse monoclonal clone CHGA(419), purified from hybridoma cell culture New human
immunohistochemistry, western blot pricing
SAB1306716 ANTI-CMGA(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
WH0001113M1 Monoclonal Anti-CHGA antibody produced in mouse clone 4D6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
AMAB90525 Monoclonal Anti-CHGA antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0166, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001275 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007693 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007693 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007693 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001275 Rosetta Predictions human pricing
NM_021655 Rosetta Predictions rat pricing
NM_007693 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331490 predicted 312
2 SASI_Hs01_00081519 predicted 1347
3 SASI_Hs01_00081520 predicted 499
4 SASI_Hs01_00081521 predicted 403
5 SASI_Hs02_00331491 predicted 377
6 SASI_Hs01_00081522 predicted 1356
7 SASI_Hs02_00331492 predicted 298
8 SASI_Hs01_00081523 predicted 1552
9 SASI_Hs01_00081525 predicted 1179
10 SASI_Hs02_00331493 predicted 368
11 SASI_Hs01_00081524 predicted 1485
12 SASI_Hs01_00081526 predicted 409
13 SASI_Hs01_00081527 predicted 394
14 SASI_Hs01_00081528 predicted 1746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033711 predicted 1371
2 SASI_Rn01_00033712 predicted 1390
3 SASI_Rn02_00262646 predicted 1576
4 SASI_Rn02_00262647 predicted 201
5 SASI_Rn01_00033713 predicted 1218
6 SASI_Rn01_00033717 predicted 1199
7 SASI_Rn01_00033716 predicted 1194
8 SASI_Rn02_00262648 predicted 960
9 SASI_Rn02_00262649 predicted 1805
10 SASI_Rn02_00262650 predicted 1704
11 SASI_Rn01_00033714 predicted 1087
12 SASI_Rn01_00033715 predicted 1227
13 SASI_Rn01_00033718 predicted 1343
14 SASI_Rn01_00033719 predicted 504
15 SASI_Rn01_00033720 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007693 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148725 predicted 1396
2 SASI_Mm01_00148726 predicted 958
3 SASI_Mm01_00148727 predicted 1400
4 SASI_Mm01_00148728 predicted 1245
5 SASI_Mm01_00148730 predicted 943
6 SASI_Mm01_00148731 predicted 1392
7 SASI_Mm01_00148732 predicted 1403
8 SASI_Mm01_00148733 predicted 1229
9 SASI_Mm02_00312234 predicted 1072
10 SASI_Mm01_00148734 predicted 803
11 SASI_Mm01_00148729 predicted 1236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001275
CHGA MISSION shRNA Bacterial Glycerol Stock
chromogranin A (parathyroid secretory protein 1)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001275.3-1042s21c1
Sequence:CCGGGCTACAAGGAGATCCGGAAAGCTCGAGCTTTCCGGATCTCCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001275.2-271s1c1
Sequence:CCGGCCTGTGAACAGCCCTATGAATCTCGAGATTCATAGGGCTGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001275.2-582s1c1
Sequence:CCGGGCCATCATCCAAGGATGTTATCTCGAGATAACATCCTTGGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001275.2-1320s1c1
Sequence:CCGGCAGTTCCATGAAGCTCTCCTTCTCGAGAAGGAGAGCTTCATGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001275.2-330s1c1
Sequence:CCGGCATCTCCGACACACTTTCCAACTCGAGTTGGAAAGTGTGTCGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001275.2-395s1c1
Sequence:CCGGGAGGAGATGAACGGATCCTTTCTCGAGAAAGGATCCGTTCATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001275
CHGA MISSION shRNA shRNA Plasmid DNA
chromogranin A (parathyroid secretory protein 1)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001275.3-1042s21c1
Sequence:CCGGGCTACAAGGAGATCCGGAAAGCTCGAGCTTTCCGGATCTCCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001275.2-271s1c1
Sequence:CCGGCCTGTGAACAGCCCTATGAATCTCGAGATTCATAGGGCTGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001275.2-582s1c1
Sequence:CCGGGCCATCATCCAAGGATGTTATCTCGAGATAACATCCTTGGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001275.2-1320s1c1
Sequence:CCGGCAGTTCCATGAAGCTCTCCTTCTCGAGAAGGAGAGCTTCATGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001275.2-330s1c1
Sequence:CCGGCATCTCCGACACACTTTCCAACTCGAGTTGGAAAGTGTGTCGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001275.2-395s1c1
Sequence:CCGGGAGGAGATGAACGGATCCTTTCTCGAGAAAGGATCCGTTCATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001275
CHGA MISSION shRNA Lentiviral Transduction Particles
chromogranin A (parathyroid secretory protein 1)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001275.3-1042s21c1
Sequence:CCGGGCTACAAGGAGATCCGGAAAGCTCGAGCTTTCCGGATCTCCTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001275.2-271s1c1
Sequence:CCGGCCTGTGAACAGCCCTATGAATCTCGAGATTCATAGGGCTGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001275.2-582s1c1
Sequence:CCGGGCCATCATCCAAGGATGTTATCTCGAGATAACATCCTTGGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001275.2-1320s1c1
Sequence:CCGGCAGTTCCATGAAGCTCTCCTTCTCGAGAAGGAGAGCTTCATGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001275.2-330s1c1
Sequence:CCGGCATCTCCGACACACTTTCCAACTCGAGTTGGAAAGTGTGTCGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001275.2-395s1c1
Sequence:CCGGGAGGAGATGAACGGATCCTTTCTCGAGAAAGGATCCGTTCATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007693
CHGA MISSION shRNA Bacterial Glycerol Stock
chromogranin A (parathyroid secretory protein 1)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007693.1-505s1c1
Sequence:CCGGCACAGCAGCTTTGAGGATGAACTCGAGTTCATCCTCAAAGCTGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007693.1-746s1c1
Sequence:CCGGCCACCAATACCCAATCACCAACTCGAGTTGGTGATTGGGTATTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007693.1-1729s1c1
Sequence:CCGGCAGGCAGCTTTCTAGAAGTTTCTCGAGAAACTTCTAGAAAGCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189575    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007693.1-1695s1c1
Sequence:CCGGCCCTGAATGTCAGCACAGATTCTCGAGAATCTGTGCTGACATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007693.1-1644s1c1
Sequence:CCGGCCTCACCTTCTCTTGTTCTCACTCGAGTGAGAACAAGAGAAGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007693.1-530s1c1
Sequence:CCGGCAGAAGTGTTTGAGAACCAGACTCGAGTCTGGTTCTCAAACACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007693
CHGA MISSION shRNA shRNA Plasmid DNA
chromogranin A (parathyroid secretory protein 1)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007693.1-505s1c1
Sequence:CCGGCACAGCAGCTTTGAGGATGAACTCGAGTTCATCCTCAAAGCTGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007693.1-746s1c1
Sequence:CCGGCCACCAATACCCAATCACCAACTCGAGTTGGTGATTGGGTATTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007693.1-1729s1c1
Sequence:CCGGCAGGCAGCTTTCTAGAAGTTTCTCGAGAAACTTCTAGAAAGCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189575    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007693.1-1695s1c1
Sequence:CCGGCCCTGAATGTCAGCACAGATTCTCGAGAATCTGTGCTGACATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007693.1-1644s1c1
Sequence:CCGGCCTCACCTTCTCTTGTTCTCACTCGAGTGAGAACAAGAGAAGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007693.1-530s1c1
Sequence:CCGGCAGAAGTGTTTGAGAACCAGACTCGAGTCTGGTTCTCAAACACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007693
CHGA MISSION shRNA Lentiviral Transduction Particles
chromogranin A (parathyroid secretory protein 1)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007693.1-505s1c1
Sequence:CCGGCACAGCAGCTTTGAGGATGAACTCGAGTTCATCCTCAAAGCTGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007693.1-746s1c1
Sequence:CCGGCCACCAATACCCAATCACCAACTCGAGTTGGTGATTGGGTATTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007693.1-1729s1c1
Sequence:CCGGCAGGCAGCTTTCTAGAAGTTTCTCGAGAAACTTCTAGAAAGCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189575    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007693.1-1695s1c1
Sequence:CCGGCCCTGAATGTCAGCACAGATTCTCGAGAATCTGTGCTGACATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007693.1-1644s1c1
Sequence:CCGGCCTCACCTTCTCTTGTTCTCACTCGAGTGAGAACAAGAGAAGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007693.1-530s1c1
Sequence:CCGGCAGAAGTGTTTGAGAACCAGACTCGAGTCTGGTTCTCAAACACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks