EMAIL THIS PAGE TO A FRIEND

CHGB

chromogranin B (secretogranin 1)

80 Gene Product Result for
Synonyms: SCG1
Gene ID:
Human(1114) Summary: This gene encodes a tyrosine-sulfated secretory protein abundant in peptidergic endocrine cells and neurons. This protein may serve as a precursor for regulatory peptides. [provided by RefSeq, Jan 2009]
Mouse(12653) chromogranin B
Rat(24259) chromogranin B (secretogranin 1)
Zebrafish(792853) chromogranin B
cow(281071) chromogranin B (secretogranin 1)
Horse(100051883) chromogranin B (secretogranin 1)
domestic cat(101088320) chromogranin B (secretogranin 1)
dog(477165) chromogranin B (secretogranin 1)
chicken(421312) chromogranin B (secretogranin 1)
domestic guinea pig(100735858) chromogranin B (secretogranin 1)
naked mole-rat(101717486) chromogranin B (secretogranin 1)
sheep(101115639) chromogranin B (secretogranin 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0568 AQUA Peptide EYGEEI[K] human pricing
AQ0566 AQUA Peptide ASEEEPEYGEEI[K] human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007694 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007694 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007694 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001819 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001819 Rosetta Predictions human pricing
NM_012526 Rosetta Predictions rat pricing
NM_007694 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332603 predicted 1803
2 SASI_Hs01_00042512 predicted 1619
3 SASI_Hs01_00042513 predicted 2207
4 SASI_Hs01_00042514 predicted 2086
5 SASI_Hs01_00042515 predicted 1961
6 SASI_Hs01_00042516 predicted 232
7 SASI_Hs01_00042517 predicted 338
8 SASI_Hs01_00042519 predicted 1504
9 SASI_Hs01_00042520 predicted 1389
10 SASI_Hs01_00042521 predicted 1946
11 SASI_Hs01_00042518 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064922 predicted 1663
2 SASI_Rn02_00259601 predicted 1637
3 SASI_Rn01_00064923 predicted 1903
4 SASI_Rn01_00064924 predicted 1639
5 SASI_Rn01_00064925 predicted 1712
6 SASI_Rn01_00064926 predicted 1036
7 SASI_Rn01_00064927 predicted 1544
8 SASI_Rn01_00064928 predicted 302
9 SASI_Rn01_00064929 predicted 1217
10 SASI_Rn01_00064930 predicted 1532
11 SASI_Rn01_00064931 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107587 predicted 519
2 SASI_Mm02_00312235 predicted 1734
3 SASI_Mm02_00312236 predicted 1740
4 SASI_Mm01_00107588 predicted 517
5 SASI_Mm01_00107589 predicted 1680
6 SASI_Mm02_00312237 predicted 2038
7 SASI_Mm01_00107590 predicted 2418
8 SASI_Mm01_00107593 predicted 1957
9 SASI_Mm01_00107594 predicted 686
10 SASI_Mm01_00107595 predicted 875
11 SASI_Mm01_00107586 predicted 1033
12 SASI_Mm01_00107591 predicted 1629
13 SASI_Mm01_00107592 predicted 1149
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007694
CHGB MISSION shRNA Bacterial Glycerol Stock
chromogranin B (secretogranin 1)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007694.1-1844s1c1
Sequence:CCGGGCTCGACTTGAAACGGCAATACTCGAGTATTGCCGTTTCAAGTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007694.1-1643s1c1
Sequence:CCGGCCAGTGGAAGAATAGTGACTTCTCGAGAAGTCACTATTCTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007694.1-498s1c1
Sequence:CCGGGCGTCCAAAGAAGCAAAGATACTCGAGTATCTTTGCTTCTTTGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007694.1-1845s1c1
Sequence:CCGGCTCGACTTGAAACGGCAATATCTCGAGATATTGCCGTTTCAAGTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007694.1-169s1c1
Sequence:CCGGGCATTATCGAAGTCCTCTCAACTCGAGTTGAGAGGACTTCGATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007694
CHGB MISSION shRNA shRNA Plasmid DNA
chromogranin B (secretogranin 1)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007694.1-1844s1c1
Sequence:CCGGGCTCGACTTGAAACGGCAATACTCGAGTATTGCCGTTTCAAGTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007694.1-1643s1c1
Sequence:CCGGCCAGTGGAAGAATAGTGACTTCTCGAGAAGTCACTATTCTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007694.1-498s1c1
Sequence:CCGGGCGTCCAAAGAAGCAAAGATACTCGAGTATCTTTGCTTCTTTGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007694.1-1845s1c1
Sequence:CCGGCTCGACTTGAAACGGCAATATCTCGAGATATTGCCGTTTCAAGTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007694.1-169s1c1
Sequence:CCGGGCATTATCGAAGTCCTCTCAACTCGAGTTGAGAGGACTTCGATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007694
CHGB MISSION shRNA Lentiviral Transduction Particles
chromogranin B (secretogranin 1)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007694.1-1844s1c1
Sequence:CCGGGCTCGACTTGAAACGGCAATACTCGAGTATTGCCGTTTCAAGTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007694.1-1643s1c1
Sequence:CCGGCCAGTGGAAGAATAGTGACTTCTCGAGAAGTCACTATTCTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007694.1-498s1c1
Sequence:CCGGGCGTCCAAAGAAGCAAAGATACTCGAGTATCTTTGCTTCTTTGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007694.1-1845s1c1
Sequence:CCGGCTCGACTTGAAACGGCAATATCTCGAGATATTGCCGTTTCAAGTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007694.1-169s1c1
Sequence:CCGGGCATTATCGAAGTCCTCTCAACTCGAGTTGAGAGGACTTCGATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001819
CHGB MISSION shRNA Bacterial Glycerol Stock
chromogranin B (secretogranin 1)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001819.1-1604s1c1
Sequence:CCGGGAAGCTAGGTTTCAAGATAAACTCGAGTTTATCTTGAAACCTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180999    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001819.1-2165s1c1
Sequence:CCGGGCACTGTTAAGAAGCAGCCATCTCGAGATGGCTGCTTCTTAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001819.1-2090s1c1
Sequence:CCGGGCTGCAATGGATTTGGAACTACTCGAGTAGTTCCAAATCCATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001819.1-1304s1c1
Sequence:CCGGGCACATGGATATGGTGAAGAACTCGAGTTCTTCACCATATCCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001819.1-1124s1c1
Sequence:CCGGGAACCTGAATATGGAGAAGAACTCGAGTTCTTCTCCATATTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001819.2-2402s21c1
Sequence:CCGGTTCACTGAAAGACACCATTTACTCGAGTAAATGGTGTCTTTCAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001819.2-374s21c1
Sequence:CCGGTGGATAACAGGAACCACAATGCTCGAGCATTGTGGTTCCTGTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001819.2-1923s21c1
Sequence:CCGGAGACAACATGAATGACAATTTCTCGAGAAATTGTCATTCATGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001819
CHGB MISSION shRNA shRNA Plasmid DNA
chromogranin B (secretogranin 1)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001819.1-1604s1c1
Sequence:CCGGGAAGCTAGGTTTCAAGATAAACTCGAGTTTATCTTGAAACCTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180999    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001819.1-2165s1c1
Sequence:CCGGGCACTGTTAAGAAGCAGCCATCTCGAGATGGCTGCTTCTTAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001819.1-2090s1c1
Sequence:CCGGGCTGCAATGGATTTGGAACTACTCGAGTAGTTCCAAATCCATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001819.1-1304s1c1
Sequence:CCGGGCACATGGATATGGTGAAGAACTCGAGTTCTTCACCATATCCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001819.1-1124s1c1
Sequence:CCGGGAACCTGAATATGGAGAAGAACTCGAGTTCTTCTCCATATTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001819.2-2402s21c1
Sequence:CCGGTTCACTGAAAGACACCATTTACTCGAGTAAATGGTGTCTTTCAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001819.2-374s21c1
Sequence:CCGGTGGATAACAGGAACCACAATGCTCGAGCATTGTGGTTCCTGTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001819.2-1923s21c1
Sequence:CCGGAGACAACATGAATGACAATTTCTCGAGAAATTGTCATTCATGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001819
CHGB MISSION shRNA Lentiviral Transduction Particles
chromogranin B (secretogranin 1)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001819.1-1604s1c1
Sequence:CCGGGAAGCTAGGTTTCAAGATAAACTCGAGTTTATCTTGAAACCTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180999    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001819.1-2165s1c1
Sequence:CCGGGCACTGTTAAGAAGCAGCCATCTCGAGATGGCTGCTTCTTAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001819.1-2090s1c1
Sequence:CCGGGCTGCAATGGATTTGGAACTACTCGAGTAGTTCCAAATCCATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001819.1-1304s1c1
Sequence:CCGGGCACATGGATATGGTGAAGAACTCGAGTTCTTCACCATATCCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001819.1-1124s1c1
Sequence:CCGGGAACCTGAATATGGAGAAGAACTCGAGTTCTTCTCCATATTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001819.2-2402s21c1
Sequence:CCGGTTCACTGAAAGACACCATTTACTCGAGTAAATGGTGTCTTTCAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001819.2-374s21c1
Sequence:CCGGTGGATAACAGGAACCACAATGCTCGAGCATTGTGGTTCCTGTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001819.2-1923s21c1
Sequence:CCGGAGACAACATGAATGACAATTTCTCGAGAAATTGTCATTCATGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks