EMAIL THIS PAGE TO A FRIEND

CHI3L1

chitinase 3-like 1 (cartilage glycoprotein-39)

88 Gene Product Result for
Synonyms: ASRT7 CGP-39 GP-39 GP39 HC-gp39 HCGP-3P YKL-40 YKL40 YYL-40 hCGP-39
UniProtKB ID: P36222, B2R7B0, P30923, Q8IVA4, Q96HI7
Gene ID:
Human(1116) Summary: Chitinases catalyze the hydrolysis of chitin, which is an abundant glycopolymer found in insect exoskeletons and fungal cell walls. The glycoside hydrolase 18 family of chitinases includes eight human family members. This gene encodes a glycoprotein member of the glycosyl hydrolase 18 family. The protein lacks chitinase activity and is secreted by activated macrophages, chondrocytes, neutrophils and synovial cells. The protein is thought to play a role in the process of inflammation and tissue remodeling. [provided by RefSeq, Sep 2009]
Mouse(12654) chitinase 3-like 1
Rat(89824) chitinase 3-like 1 (cartilage glycoprotein-39)
cow(286869) chitinase 3-like 1 (cartilage glycoprotein-39)
Horse(100052556) chitinase 3-like 1 (cartilage glycoprotein-39)
domestic cat(101100781) chitinase 3-like 1 (cartilage glycoprotein-39)
dog(490222) chitinase 3-like 1 (cartilage glycoprotein-39)
Goat(100860825) chitinase 3-like 1 (cartilage glycoprotein-39)
sheep(443279) chitinase 3-like 1 (cartilage glycoprotein-39)
Domestic Rabbit(100338424) chitinase 3-like 1 (cartilage glycoprotein-39)
naked mole-rat(101703445) chitinase 3-like 1 (cartilage glycoprotein-39)
domestic guinea pig(100721724) chitinase 3-like 1 (cartilage glycoprotein-39)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0639 Human CHI3L1 / Chitinase-3-like Protein 1 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007695 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007695 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007695 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001276 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU079811 MISSION® esiRNA esiRNA targeting mouse Chi3l1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001276 Rosetta Predictions human pricing
NM_053560 Rosetta Predictions rat pricing
NM_007695 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221603 predicted 1514
2 SASI_Hs01_00221604 predicted 1538
3 SASI_Hs02_00331494 predicted 1048
4 SASI_Hs01_00221605 predicted 1545
5 SASI_Hs01_00221606 predicted 1533
6 SASI_Hs01_00221607 predicted 627
7 SASI_Hs01_00221608 predicted 346
8 SASI_Hs01_00221609 predicted 628
9 SASI_Hs02_00331495 predicted 226
10 SASI_Hs02_00331496 predicted 528
11 SASI_Hs01_00221602 predicted 1515
12 SASI_Hs01_00221610 predicted 334
13 SASI_Hs01_00221611 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113301 predicted 1134
2 SASI_Rn01_00113302 predicted 280
3 SASI_Rn01_00113303 predicted 374
4 SASI_Rn01_00113304 predicted 210
5 SASI_Rn01_00113305 predicted 931
6 SASI_Rn01_00113306 predicted 615
7 SASI_Rn01_00113307 predicted 400
8 SASI_Rn01_00113308 predicted 1288
9 SASI_Rn02_00266219 predicted 587
10 SASI_Rn01_00113309 predicted 271
11 SASI_Rn01_00113310 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068484 predicted 241
2 SASI_Mm01_00068485 predicted 510
3 SASI_Mm01_00068486 predicted 1228
4 SASI_Mm02_00312238 predicted 329
5 SASI_Mm01_00068487 predicted 482
6 SASI_Mm01_00068488 predicted 277
7 SASI_Mm01_00068489 predicted 925
8 SASI_Mm01_00068490 predicted 731
9 SASI_Mm01_00068491 predicted 220
10 SASI_Mm01_00068492 predicted 597
11 SASI_Mm01_00068493 predicted 290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007695
CHI3L1 MISSION shRNA Bacterial Glycerol Stock
chitinase 3-like 1 (cartilage glycoprotein-39)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007695.3-410s21c1
Sequence:CCGGTCTGTTGGAGGGTGGAAATTTCTCGAGAAATTTCCACCCTCCAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007695.3-1536s21c1
Sequence:CCGGACTTGGATCAAGTAGGCAAATCTCGAGATTTGCCTACTTGATCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007695.1-1406s1c1
Sequence:CCGGGCAGATACACAACCCTGTTAACTCGAGTTAACAGGGTTGTGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007695.1-515s1c1
Sequence:CCGGGCAGTATTTCTCCACCCTGATCTCGAGATCAGGGTGGAGAAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007695.1-453s1c1
Sequence:CCGGCTGCGTTCTTATGGCTTTGATCTCGAGATCAAAGCCATAAGAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007695.1-452s1c1
Sequence:CCGGCCTGCGTTCTTATGGCTTTGACTCGAGTCAAAGCCATAAGAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007695.1-326s1c1
Sequence:CCGGGACCAGAAACACCAACCTGAACTCGAGTTCAGGTTGGTGTTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007695
CHI3L1 MISSION shRNA shRNA Plasmid DNA
chitinase 3-like 1 (cartilage glycoprotein-39)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007695.3-410s21c1
Sequence:CCGGTCTGTTGGAGGGTGGAAATTTCTCGAGAAATTTCCACCCTCCAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007695.3-1536s21c1
Sequence:CCGGACTTGGATCAAGTAGGCAAATCTCGAGATTTGCCTACTTGATCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007695.1-1406s1c1
Sequence:CCGGGCAGATACACAACCCTGTTAACTCGAGTTAACAGGGTTGTGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007695.1-515s1c1
Sequence:CCGGGCAGTATTTCTCCACCCTGATCTCGAGATCAGGGTGGAGAAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007695.1-453s1c1
Sequence:CCGGCTGCGTTCTTATGGCTTTGATCTCGAGATCAAAGCCATAAGAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007695.1-452s1c1
Sequence:CCGGCCTGCGTTCTTATGGCTTTGACTCGAGTCAAAGCCATAAGAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007695.1-326s1c1
Sequence:CCGGGACCAGAAACACCAACCTGAACTCGAGTTCAGGTTGGTGTTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007695
CHI3L1 MISSION shRNA Lentiviral Transduction Particles
chitinase 3-like 1 (cartilage glycoprotein-39)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007695.3-410s21c1
Sequence:CCGGTCTGTTGGAGGGTGGAAATTTCTCGAGAAATTTCCACCCTCCAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007695.3-1536s21c1
Sequence:CCGGACTTGGATCAAGTAGGCAAATCTCGAGATTTGCCTACTTGATCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007695.1-1406s1c1
Sequence:CCGGGCAGATACACAACCCTGTTAACTCGAGTTAACAGGGTTGTGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007695.1-515s1c1
Sequence:CCGGGCAGTATTTCTCCACCCTGATCTCGAGATCAGGGTGGAGAAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007695.1-453s1c1
Sequence:CCGGCTGCGTTCTTATGGCTTTGATCTCGAGATCAAAGCCATAAGAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007695.1-452s1c1
Sequence:CCGGCCTGCGTTCTTATGGCTTTGACTCGAGTCAAAGCCATAAGAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007695.1-326s1c1
Sequence:CCGGGACCAGAAACACCAACCTGAACTCGAGTTCAGGTTGGTGTTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001276
CHI3L1 MISSION shRNA Bacterial Glycerol Stock
chitinase 3-like 1 (cartilage glycoprotein-39)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001276.2-529s21c1
Sequence:CCGGATCAAGTCAGTACCGCCATTTCTCGAGAAATGGCGGTACTGACTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001276.2-1642s21c1
Sequence:CCGGCCTTATCAAAGGACACCATTTCTCGAGAAATGGTGTCCTTTGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001276.2-774s21c1
Sequence:CCGGTAGCATCATGACCTACGATTTCTCGAGAAATCGTAGGTCATGATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001276.1-588s1c1
Sequence:CCGGCAAGGAAATGAAGGCCGAATTCTCGAGAATTCGGCCTTCATTTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001276.1-419s1c1
Sequence:CCGGGATGGAACTTTGGGTCTCAAACTCGAGTTTGAGACCCAAAGTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001276.1-817s1c1
Sequence:CCGGCCTGACAGATTCAGCAACACTCTCGAGAGTGTTGCTGAATCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001276.1-171s1c1
Sequence:CCGGGCTCCAGTGCTGCTCTGCATACTCGAGTATGCAGAGCAGCACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001276
CHI3L1 MISSION shRNA shRNA Plasmid DNA
chitinase 3-like 1 (cartilage glycoprotein-39)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001276.2-529s21c1
Sequence:CCGGATCAAGTCAGTACCGCCATTTCTCGAGAAATGGCGGTACTGACTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001276.2-1642s21c1
Sequence:CCGGCCTTATCAAAGGACACCATTTCTCGAGAAATGGTGTCCTTTGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001276.2-774s21c1
Sequence:CCGGTAGCATCATGACCTACGATTTCTCGAGAAATCGTAGGTCATGATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001276.1-588s1c1
Sequence:CCGGCAAGGAAATGAAGGCCGAATTCTCGAGAATTCGGCCTTCATTTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001276.1-419s1c1
Sequence:CCGGGATGGAACTTTGGGTCTCAAACTCGAGTTTGAGACCCAAAGTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001276.1-817s1c1
Sequence:CCGGCCTGACAGATTCAGCAACACTCTCGAGAGTGTTGCTGAATCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001276.1-171s1c1
Sequence:CCGGGCTCCAGTGCTGCTCTGCATACTCGAGTATGCAGAGCAGCACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001276
CHI3L1 MISSION shRNA Lentiviral Transduction Particles
chitinase 3-like 1 (cartilage glycoprotein-39)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001276.2-529s21c1
Sequence:CCGGATCAAGTCAGTACCGCCATTTCTCGAGAAATGGCGGTACTGACTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001276.2-1642s21c1
Sequence:CCGGCCTTATCAAAGGACACCATTTCTCGAGAAATGGTGTCCTTTGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001276.2-774s21c1
Sequence:CCGGTAGCATCATGACCTACGATTTCTCGAGAAATCGTAGGTCATGATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001276.1-588s1c1
Sequence:CCGGCAAGGAAATGAAGGCCGAATTCTCGAGAATTCGGCCTTCATTTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001276.1-419s1c1
Sequence:CCGGGATGGAACTTTGGGTCTCAAACTCGAGTTTGAGACCCAAAGTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001276.1-817s1c1
Sequence:CCGGCCTGACAGATTCAGCAACACTCTCGAGAGTGTTGCTGAATCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001276.1-171s1c1
Sequence:CCGGGCTCCAGTGCTGCTCTGCATACTCGAGTATGCAGAGCAGCACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks