EMAIL THIS PAGE TO A FRIEND

CHI3L2

chitinase 3-like 2

47 Gene Product Result for
Synonyms: CHIL2 YKL-39 YKL39
Gene ID:
Human(1117) Summary: The protein encoded by this gene is similar to bacterial chitinases but lacks chitinase activity. The encoded protein is secreted and is involved in cartilage biogenesis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
sheep(101106229) chitinase 3-like 2
Domestic Rabbit(100352595) chitinase 3-like 2
cow(513513) chitinase 3-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1363 Human CHI3L2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004000 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004000 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004000 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009261 MISSION® esiRNA esiRNA targeting human CHI3L2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025197 Rosetta Predictions human pricing
NM_001025199 Rosetta Predictions human pricing
NM_004000 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144498 predicted 1041
2 SASI_Hs01_00144499 predicted 943
3 SASI_Hs01_00144500 predicted 1108
4 SASI_Hs01_00144501 predicted 758
5 SASI_Hs02_00307400 predicted 754
6 SASI_Hs01_00144502 predicted 401
7 SASI_Hs01_00144504 predicted 469
8 SASI_Hs01_00144505 predicted 569
9 SASI_Hs01_00144506 predicted 602
10 SASI_Hs02_00307401 predicted 1122
11 SASI_Hs01_00144503 predicted 700
12 SASI_Hs01_00144507 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038019 predicted 1100
2 SASI_Hs01_00038020 predicted 1006
3 SASI_Hs01_00038021 predicted 1168
4 SASI_Hs01_00038022 predicted 818
5 SASI_Hs02_00307402 predicted 813
6 SASI_Hs01_00038023 predicted 457
7 SASI_Hs01_00038025 predicted 524
8 SASI_Hs01_00038026 predicted 626
9 SASI_Hs01_00038027 predicted 668
10 SASI_Hs02_00307403 predicted 1173
11 SASI_Hs01_00038024 predicted 762
12 SASI_Hs01_00038028 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106277 predicted 1074
2 SASI_Hs01_00106278 predicted 972
3 SASI_Hs01_00106279 predicted 1134
4 SASI_Hs01_00106280 predicted 792
5 SASI_Hs02_00336722 predicted 792
6 SASI_Hs01_00106281 predicted 428
7 SASI_Hs01_00106283 predicted 498
8 SASI_Hs01_00106284 predicted 599
9 SASI_Hs01_00106285 predicted 635
10 SASI_Hs02_00336723 predicted 1151
11 SASI_Hs01_00106282 predicted 734
12 SASI_Hs01_00106286 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004000
CHI3L2 MISSION shRNA Bacterial Glycerol Stock
chitinase 3-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004000.1-739s1c1
Sequence:CCGGGCTCCTACTACAATGTGGAATCTCGAGATTCCACATTGTAGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004000.1-407s1c1
Sequence:CCGGCCTGTTTCTGAGGAACCATAACTCGAGTTATGGTTCCTCAGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004000.1-1047s1c1
Sequence:CCGGGAGACCAAGGTTCAGTTCTTACTCGAGTAAGAACTGAACCTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004000.1-267s1c1
Sequence:CCGGCAGACCATCAACAGTCTCAAACTCGAGTTTGAGACTGTTGATGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004000.1-539s1c1
Sequence:CCGGCACCAAGGAAAGGCTTCTCTTCTCGAGAAGAGAAGCCTTTCCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004000.2-966s21c1
Sequence:CCGGTCAGGCTTCCTGGCCTATTATCTCGAGATAATAGGCCAGGAAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004000.2-1233s21c1
Sequence:CCGGGGCTCCCTGTGAAGGATTAACCTCGAGGTTAATCCTTCACAGGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004000.2-235s21c1
Sequence:CCGGTATGCTCTCATCTCATCTATTCTCGAGAATAGATGAGATGAGAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004000
CHI3L2 MISSION shRNA shRNA Plasmid DNA
chitinase 3-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004000.1-739s1c1
Sequence:CCGGGCTCCTACTACAATGTGGAATCTCGAGATTCCACATTGTAGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004000.1-407s1c1
Sequence:CCGGCCTGTTTCTGAGGAACCATAACTCGAGTTATGGTTCCTCAGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004000.1-1047s1c1
Sequence:CCGGGAGACCAAGGTTCAGTTCTTACTCGAGTAAGAACTGAACCTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004000.1-267s1c1
Sequence:CCGGCAGACCATCAACAGTCTCAAACTCGAGTTTGAGACTGTTGATGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004000.1-539s1c1
Sequence:CCGGCACCAAGGAAAGGCTTCTCTTCTCGAGAAGAGAAGCCTTTCCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004000.2-966s21c1
Sequence:CCGGTCAGGCTTCCTGGCCTATTATCTCGAGATAATAGGCCAGGAAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004000.2-1233s21c1
Sequence:CCGGGGCTCCCTGTGAAGGATTAACCTCGAGGTTAATCCTTCACAGGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004000.2-235s21c1
Sequence:CCGGTATGCTCTCATCTCATCTATTCTCGAGAATAGATGAGATGAGAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004000
CHI3L2 MISSION shRNA Lentiviral Transduction Particles
chitinase 3-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004000.1-739s1c1
Sequence:CCGGGCTCCTACTACAATGTGGAATCTCGAGATTCCACATTGTAGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004000.1-407s1c1
Sequence:CCGGCCTGTTTCTGAGGAACCATAACTCGAGTTATGGTTCCTCAGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004000.1-1047s1c1
Sequence:CCGGGAGACCAAGGTTCAGTTCTTACTCGAGTAAGAACTGAACCTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004000.1-267s1c1
Sequence:CCGGCAGACCATCAACAGTCTCAAACTCGAGTTTGAGACTGTTGATGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004000.1-539s1c1
Sequence:CCGGCACCAAGGAAAGGCTTCTCTTCTCGAGAAGAGAAGCCTTTCCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004000.2-966s21c1
Sequence:CCGGTCAGGCTTCCTGGCCTATTATCTCGAGATAATAGGCCAGGAAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004000.2-1233s21c1
Sequence:CCGGGGCTCCCTGTGAAGGATTAACCTCGAGGTTAATCCTTCACAGGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004000.2-235s21c1
Sequence:CCGGTATGCTCTCATCTCATCTATTCTCGAGAATAGATGAGATGAGAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks