EMAIL THIS PAGE TO A FRIEND

CHIA

chitinase, acidic

75 Gene Product Result for
Synonyms: AMCASE CHIT2 TSA1902
Gene ID:
Human(27159) Summary: The protein encoded by this gene degrades chitin, which is found in the cell wall of most fungi as well as in arthropods and some nematodes. The encoded protein can also stimulate interleukin 13 expression, and variations in this gene can lead to asthma susceptibility. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(81600) chitinase, acidic
Rat(113901) chitinase, acidic
sheep(100049063) chitinase, acidic
Thale Cress(832474) chitinase A
cow(282645) chitinase, acidic
chicken(395072) chitinase, acidic
domestic cat(101096501) chitinase, acidic
dog(479904) chitinase, acidic
chicken(419931) chitinase, acidic
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
CS0980 Chitinase Assay Kit sufficient for 100 multiwell tests human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023186 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023186 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023186 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021797 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021797 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021797 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147401 MISSION® esiRNA esiRNA human CHIA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040623 Rosetta Predictions human pricing
NM_021797 Rosetta Predictions human pricing
NM_201653 Rosetta Predictions human pricing
NM_207586 Rosetta Predictions rat pricing
NM_023186 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131127 predicted 745
2 SASI_Hs01_00131128 predicted 481
3 SASI_Hs01_00131129 predicted 531
4 SASI_Hs01_00131130 predicted 740
5 SASI_Hs01_00131131 predicted 670
6 SASI_Hs01_00131132 predicted 497
7 SASI_Hs01_00131133 predicted 691
8 SASI_Hs01_00131134 predicted 741
9 SASI_Hs01_00131135 predicted 603
10 SASI_Hs01_00131136 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242598 predicted 867
2 SASI_Hs01_00242599 predicted 608
3 SASI_Hs01_00242600 predicted 655
4 SASI_Hs01_00242601 predicted 866
5 SASI_Hs01_00242602 predicted 802
6 SASI_Hs01_00242603 predicted 622
7 SASI_Hs01_00242604 predicted 819
8 SASI_Hs01_00242605 predicted 866
9 SASI_Hs01_00242606 predicted 732
10 SASI_Hs01_00242607 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109702 predicted 1143
2 SASI_Hs01_00109703 predicted 873
3 SASI_Hs01_00109704 predicted 930
4 SASI_Hs01_00109705 predicted 1134
5 SASI_Hs01_00109706 predicted 1074
6 SASI_Hs01_00109707 predicted 887
7 SASI_Hs01_00109708 predicted 1087
8 SASI_Hs01_00109709 predicted 1135
9 SASI_Hs01_00109710 predicted 998
10 SASI_Hs01_00109711 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063103 predicted 211
2 SASI_Rn01_00063104 predicted 237
3 SASI_Rn01_00063106 predicted 226
4 SASI_Rn01_00063107 predicted 1218
5 SASI_Rn01_00063108 predicted 1060
6 SASI_Rn01_00063109 predicted 687
7 SASI_Rn02_00270400 predicted 206
8 SASI_Rn01_00063111 predicted 932
9 SASI_Rn02_00270401 predicted 544
10 SASI_Rn02_00270402 predicted 620
11 SASI_Rn01_00063105 predicted 1019
12 SASI_Rn01_00063110 predicted 748
13 SASI_Rn01_00063112 predicted 1288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063378 predicted 1039
2 SASI_Mm01_00063379 predicted 672
3 SASI_Mm02_00326909 predicted 913
4 SASI_Mm01_00063380 predicted 613
5 SASI_Mm02_00326910 predicted 732
6 SASI_Mm01_00063383 predicted 1104
7 SASI_Mm02_00326911 predicted 597
8 SASI_Mm02_00326912 predicted 354
9 SASI_Mm01_00063384 predicted 792
10 SASI_Mm01_00063386 predicted 720
11 SASI_Mm01_00063381 predicted 222
12 SASI_Mm01_00063382 predicted 203
13 SASI_Mm01_00063385 predicted 219
14 SASI_Mm01_00063387 predicted 586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023186
CHIA MISSION shRNA Bacterial Glycerol Stock
chitinase, acidic
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023186.3-64s1c1
Sequence:CCGGGCCTACAATCTGATATGCTATCTCGAGATAGCATATCAGATTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023186.3-205s1c1
Sequence:CCGGACCATAGAATGGAATGATGTTCTCGAGAACATCATTCCATTCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023186.3-300s1c1
Sequence:CCGGGAACTTTGGAACTGCTCCTTTCTCGAGAAAGGAGCAGTTCCAAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023186.3-314s1c1
Sequence:CCGGCTCCTTTCACTACCATGGTTTCTCGAGAAACCATGGTAGTGAAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023186.3-718s1c1
Sequence:CCGGGCCTACCTCAATGTGGATTATCTCGAGATAATCCACATTGAGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023186
CHIA MISSION shRNA shRNA Plasmid DNA
chitinase, acidic
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023186.3-64s1c1
Sequence:CCGGGCCTACAATCTGATATGCTATCTCGAGATAGCATATCAGATTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023186.3-205s1c1
Sequence:CCGGACCATAGAATGGAATGATGTTCTCGAGAACATCATTCCATTCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023186.3-300s1c1
Sequence:CCGGGAACTTTGGAACTGCTCCTTTCTCGAGAAAGGAGCAGTTCCAAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023186.3-314s1c1
Sequence:CCGGCTCCTTTCACTACCATGGTTTCTCGAGAAACCATGGTAGTGAAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023186.3-718s1c1
Sequence:CCGGGCCTACCTCAATGTGGATTATCTCGAGATAATCCACATTGAGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023186
CHIA MISSION shRNA Lentiviral Transduction Particles
chitinase, acidic
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023186.3-64s1c1
Sequence:CCGGGCCTACAATCTGATATGCTATCTCGAGATAGCATATCAGATTGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023186.3-205s1c1
Sequence:CCGGACCATAGAATGGAATGATGTTCTCGAGAACATCATTCCATTCTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023186.3-300s1c1
Sequence:CCGGGAACTTTGGAACTGCTCCTTTCTCGAGAAAGGAGCAGTTCCAAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023186.3-314s1c1
Sequence:CCGGCTCCTTTCACTACCATGGTTTCTCGAGAAACCATGGTAGTGAAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023186.3-718s1c1
Sequence:CCGGGCCTACCTCAATGTGGATTATCTCGAGATAATCCACATTGAGGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021797
CHIA MISSION shRNA Bacterial Glycerol Stock
chitinase, acidic
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021797.2-805s1c1
Sequence:CCGGCCTTATGCCTATCAGGGCAATCTCGAGATTGCCCTGATAGGCATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021797.2-843s1c1
Sequence:CCGGCAACATCAAGAGCTTCGATATCTCGAGATATCGAAGCTCTTGATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021797.2-885s1c1
Sequence:CCGGCAACAAATTTGGAGGCGCCATCTCGAGATGGCGCCTCCAAATTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021797.2-854s1c1
Sequence:CCGGGCTTCGATATTAAGGCTCAATCTCGAGATTGAGCCTTAATATCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021797.2-1025s1c1
Sequence:CCGGCTCAGCCCATTGAGCCAATAACTCGAGTTATTGGCTCAATGGGCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021797.2-729s1c1
Sequence:CCGGGATCTGGGCTTACTACGAGATCTCGAGATCTCGTAGTAAGCCCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021797
CHIA MISSION shRNA shRNA Plasmid DNA
chitinase, acidic
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021797.2-805s1c1
Sequence:CCGGCCTTATGCCTATCAGGGCAATCTCGAGATTGCCCTGATAGGCATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021797.2-843s1c1
Sequence:CCGGCAACATCAAGAGCTTCGATATCTCGAGATATCGAAGCTCTTGATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021797.2-885s1c1
Sequence:CCGGCAACAAATTTGGAGGCGCCATCTCGAGATGGCGCCTCCAAATTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021797.2-854s1c1
Sequence:CCGGGCTTCGATATTAAGGCTCAATCTCGAGATTGAGCCTTAATATCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021797.2-1025s1c1
Sequence:CCGGCTCAGCCCATTGAGCCAATAACTCGAGTTATTGGCTCAATGGGCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021797.2-729s1c1
Sequence:CCGGGATCTGGGCTTACTACGAGATCTCGAGATCTCGTAGTAAGCCCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021797
CHIA MISSION shRNA Lentiviral Transduction Particles
chitinase, acidic
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021797.2-805s1c1
Sequence:CCGGCCTTATGCCTATCAGGGCAATCTCGAGATTGCCCTGATAGGCATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021797.2-843s1c1
Sequence:CCGGCAACATCAAGAGCTTCGATATCTCGAGATATCGAAGCTCTTGATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021797.2-885s1c1
Sequence:CCGGCAACAAATTTGGAGGCGCCATCTCGAGATGGCGCCTCCAAATTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021797.2-854s1c1
Sequence:CCGGGCTTCGATATTAAGGCTCAATCTCGAGATTGAGCCTTAATATCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021797.2-1025s1c1
Sequence:CCGGCTCAGCCCATTGAGCCAATAACTCGAGTTATTGGCTCAATGGGCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021797.2-729s1c1
Sequence:CCGGGATCTGGGCTTACTACGAGATCTCGAGATCTCGTAGTAAGCCCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)