EMAIL THIS PAGE TO A FRIEND

CHID1

chitinase domain containing 1

Synonyms: SI-CLP
Gene ID:
Mouse(68038) chitinase domain containing 1
Rat(293628) chitinase domain containing 1
Zebrafish(337225) chitinase domain containing 1
cow(504781) chitinase domain containing 1
Horse(100056279) chitinase domain containing 1
domestic cat(101097518) chitinase domain containing 1
dog(475993) chitinase domain containing 1
chicken(423103) chitinase domain containing 1
sheep(101102943) chitinase domain containing 1
domestic guinea pig(100715835) chitinase domain containing 1
naked mole-rat(101721256) chitinase domain containing 1
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023947 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026522 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026522 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026522 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023947 Rosetta Predictions human pricing
NM_001047854 Rosetta Predictions rat pricing
NM_026522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162336 predicted 360
2 SASI_Hs01_00162337 predicted 1104
3 SASI_Hs01_00162339 predicted 323
4 SASI_Hs01_00162340 predicted 874
5 SASI_Hs01_00162341 predicted 547
6 SASI_Hs01_00162343 predicted 816
7 SASI_Hs02_00356418 predicted 584
8 SASI_Hs01_00162344 predicted 299
9 SASI_Hs02_00356419 predicted 679
10 SASI_Hs01_00162345 predicted 553
11 SASI_Hs01_00162338 predicted 895
12 SASI_Hs01_00162342 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047854 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206215 predicted 875
2 SASI_Rn02_00206216 predicted 1007
3 SASI_Rn02_00206217 predicted 1080
4 SASI_Rn02_00206218 predicted 1011
5 SASI_Rn02_00206219 predicted 471
6 SASI_Rn02_00206220 predicted 529
7 SASI_Rn02_00206221 predicted 354
8 SASI_Rn02_00206222 predicted 956
9 SASI_Rn02_00206223 predicted 869
10 SASI_Rn02_00206224 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188459 predicted 1136
2 SASI_Mm01_00188460 predicted 539
3 SASI_Mm01_00188461 predicted 1126
4 SASI_Mm01_00188462 predicted 538
5 SASI_Mm01_00188463 predicted 477
6 SASI_Mm01_00188464 predicted 1070
7 SASI_Mm01_00188465 predicted 527
8 SASI_Mm01_00188466 predicted 864
9 SASI_Mm01_00188467 predicted 256
10 SASI_Mm01_00188468 predicted 876
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023947
VALIDATED
CHID1 MISSION shRNA Bacterial Glycerol Stock
chitinase domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_023947.2-633s1c1
Sequence:CCGGGCAAAGAACCAGCATTTCGATCTCGAGATCGAAATGCTGGTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_023947.2-368s1c1
Sequence:CCGGCTACGATGTCACCAAGGTCTTCTCGAGAAGACCTTGGTGACATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_023947.2-152s1c1
Sequence:CCGGCCTGTCAAAGTCAGATGCCAACTCGAGTTGGCATCTGACTTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_023947.2-1112s1c1
Sequence:CCGGGCACTTCTTCGAGTACAAGAACTCGAGTTCTTGTACTCGAAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023947.3-1664s21c1
Sequence:CCGGTGGGTTTGGAAGCTCTGGAACCTCGAGGTTCCAGAGCTTCCAAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023947.3-862s21c1
Sequence:CCGGTGTTCACGCACAAGGAGTTTGCTCGAGCAAACTCCTTGTGCGTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023947.3-916s21c1
Sequence:CCGGTCATGACCTACGACTACTCTACTCGAGTAGAGTAGTCGTAGGTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023947.3-602s21c1
Sequence:CCGGGGACTGGACTTACGATGATTTCTCGAGAAATCATCGTAAGTCCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023947
VALIDATED
CHID1 MISSION shRNA shRNA Plasmid DNA
chitinase domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_023947.2-633s1c1
Sequence:CCGGGCAAAGAACCAGCATTTCGATCTCGAGATCGAAATGCTGGTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_023947.2-368s1c1
Sequence:CCGGCTACGATGTCACCAAGGTCTTCTCGAGAAGACCTTGGTGACATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_023947.2-152s1c1
Sequence:CCGGCCTGTCAAAGTCAGATGCCAACTCGAGTTGGCATCTGACTTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_023947.2-1112s1c1
Sequence:CCGGGCACTTCTTCGAGTACAAGAACTCGAGTTCTTGTACTCGAAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023947.3-1664s21c1
Sequence:CCGGTGGGTTTGGAAGCTCTGGAACCTCGAGGTTCCAGAGCTTCCAAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023947.3-862s21c1
Sequence:CCGGTGTTCACGCACAAGGAGTTTGCTCGAGCAAACTCCTTGTGCGTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023947.3-916s21c1
Sequence:CCGGTCATGACCTACGACTACTCTACTCGAGTAGAGTAGTCGTAGGTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023947.3-602s21c1
Sequence:CCGGGGACTGGACTTACGATGATTTCTCGAGAAATCATCGTAAGTCCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023947
VALIDATED
CHID1 MISSION shRNA Lentiviral Transduction Particles
chitinase domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_023947.2-633s1c1
Sequence:CCGGGCAAAGAACCAGCATTTCGATCTCGAGATCGAAATGCTGGTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_023947.2-368s1c1
Sequence:CCGGCTACGATGTCACCAAGGTCTTCTCGAGAAGACCTTGGTGACATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_023947.2-152s1c1
Sequence:CCGGCCTGTCAAAGTCAGATGCCAACTCGAGTTGGCATCTGACTTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_023947.2-1112s1c1
Sequence:CCGGGCACTTCTTCGAGTACAAGAACTCGAGTTCTTGTACTCGAAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023947.3-1664s21c1
Sequence:CCGGTGGGTTTGGAAGCTCTGGAACCTCGAGGTTCCAGAGCTTCCAAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023947.3-862s21c1
Sequence:CCGGTGTTCACGCACAAGGAGTTTGCTCGAGCAAACTCCTTGTGCGTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023947.3-916s21c1
Sequence:CCGGTCATGACCTACGACTACTCTACTCGAGTAGAGTAGTCGTAGGTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023947.3-602s21c1
Sequence:CCGGGGACTGGACTTACGATGATTTCTCGAGAAATCATCGTAAGTCCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026522
VALIDATED
CHID1 MISSION shRNA Bacterial Glycerol Stock
chitinase domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026522.2-353s1c1
Sequence:CCGGCTACGATGTTGCCAAGGTCTTCTCGAGAAGACCTTGGCAACATCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026522.2-675s1c1
Sequence:CCGGCAGAAACATGTAGGCCTCATTCTCGAGAATGAGGCCTACATGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026522.2-839s1c1
Sequence:CCGGGCACTTCTTTGAGTACAAGAACTCGAGTTCTTGTACTCAAAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026522.2-365s1c1
Sequence:CCGGCAAGGTCTTTGGGAGCAAGTTCTCGAGAACTTGCTCCCAAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026522.5-727s21c1
Sequence:CCGGCAGAAACATGTAGGCCTCATTCTCGAGAATGAGGCCTACATGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026522.5-1421s21c1
Sequence:CCGGTACCACAAACACGGGTATATTCTCGAGAATATACCCGTGTTTGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026522.5-602s21c1
Sequence:CCGGATGATTTCCGAAACGTCTTAGCTCGAGCTAAGACGTTTCGGAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026522.5-417s21c1
Sequence:CCGGCAAGGTCTTTGGGAGCAAGTTCTCGAGAACTTGCTCCCAAAGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026522.5-891s21c1
Sequence:CCGGGCACTTCTTTGAGTACAAGAACTCGAGTTCTTGTACTCAAAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026522
VALIDATED
CHID1 MISSION shRNA shRNA Plasmid DNA
chitinase domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026522.2-353s1c1
Sequence:CCGGCTACGATGTTGCCAAGGTCTTCTCGAGAAGACCTTGGCAACATCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026522.2-675s1c1
Sequence:CCGGCAGAAACATGTAGGCCTCATTCTCGAGAATGAGGCCTACATGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026522.2-839s1c1
Sequence:CCGGGCACTTCTTTGAGTACAAGAACTCGAGTTCTTGTACTCAAAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026522.2-365s1c1
Sequence:CCGGCAAGGTCTTTGGGAGCAAGTTCTCGAGAACTTGCTCCCAAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026522.5-727s21c1
Sequence:CCGGCAGAAACATGTAGGCCTCATTCTCGAGAATGAGGCCTACATGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026522.5-1421s21c1
Sequence:CCGGTACCACAAACACGGGTATATTCTCGAGAATATACCCGTGTTTGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026522.5-602s21c1
Sequence:CCGGATGATTTCCGAAACGTCTTAGCTCGAGCTAAGACGTTTCGGAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026522.5-417s21c1
Sequence:CCGGCAAGGTCTTTGGGAGCAAGTTCTCGAGAACTTGCTCCCAAAGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026522.5-891s21c1
Sequence:CCGGGCACTTCTTTGAGTACAAGAACTCGAGTTCTTGTACTCAAAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026522
VALIDATED
CHID1 MISSION shRNA Lentiviral Transduction Particles
chitinase domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026522.2-353s1c1
Sequence:CCGGCTACGATGTTGCCAAGGTCTTCTCGAGAAGACCTTGGCAACATCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026522.2-675s1c1
Sequence:CCGGCAGAAACATGTAGGCCTCATTCTCGAGAATGAGGCCTACATGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026522.2-839s1c1
Sequence:CCGGGCACTTCTTTGAGTACAAGAACTCGAGTTCTTGTACTCAAAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026522.2-365s1c1
Sequence:CCGGCAAGGTCTTTGGGAGCAAGTTCTCGAGAACTTGCTCCCAAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026522.5-727s21c1
Sequence:CCGGCAGAAACATGTAGGCCTCATTCTCGAGAATGAGGCCTACATGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026522.5-1421s21c1
Sequence:CCGGTACCACAAACACGGGTATATTCTCGAGAATATACCCGTGTTTGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026522.5-602s21c1
Sequence:CCGGATGATTTCCGAAACGTCTTAGCTCGAGCTAAGACGTTTCGGAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026522.5-417s21c1
Sequence:CCGGCAAGGTCTTTGGGAGCAAGTTCTCGAGAACTTGCTCCCAAAGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026522.5-891s21c1
Sequence:CCGGGCACTTCTTTGAGTACAAGAACTCGAGTTCTTGTACTCAAAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks