EMAIL THIS PAGE TO A FRIEND

CHIT1

chitinase 1 (chitotriosidase)

61 Gene Product Result for
Synonyms: CHI3 CHIT CHITD
Gene ID:
Human(1118) Summary: Chitotriosidase is secreted by activated human macrophages and is markedly elevated in plasma of Gaucher disease patients. The expression of chitotriosidase occurs only at a late stage of differentiation of monocytes to activated macrophages in culture. Human macrophages can synthesize a functional chitotriosidase, a highly conserved enzyme with a strongly regulated expression. This enzyme may play a role in the degradation of chitin-containing pathogens. Several alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2012]
Mouse(71884) chitinase 1 (chitotriosidase)
Rat(289032) chitinase 1 (chitotriosidase)
domestic cat(101081696) chitinase 1 (chitotriosidase)
cow(789394) chitinase 1 (chitotriosidase)
Horse(100065255) chitinase 1 (chitotriosidase)
naked mole-rat(101702614) chitinase 1 (chitotriosidase)
domestic guinea pig(100721444) chitinase 1 (chitotriosidase)
Domestic Rabbit(100338170) chitinase 1 (chitotriosidase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Activity Assay

Product # Description Species Add to Cart
 
CS1030 Chitinase Assay Kit, Fluorimetric sufficient for 200 multiwell tests human pricing

Kits

Product # Description Species Add to Cart
 
CS0980 Chitinase Assay Kit sufficient for 100 multiwell tests human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003465 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157041 MISSION® esiRNA esiRNA human CHIT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003465 Rosetta Predictions human pricing
NM_001079689 Rosetta Predictions rat pricing
NM_027979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335711 predicted 1731
2 SASI_Hs02_00335712 predicted 431
3 SASI_Hs02_00335713 predicted 1719
4 SASI_Hs02_00335714 predicted 1711
5 SASI_Hs02_00335715 predicted 427
6 SASI_Hs01_00013722 predicted 652
7 SASI_Hs02_00335716 predicted 1057
8 SASI_Hs02_00335717 predicted 405
9 SASI_Hs02_00335718 predicted 359
10 SASI_Hs02_00335719 predicted 1722
11 SASI_Hs01_00013714 predicted 531
12 SASI_Hs01_00013715 predicted 1258
13 SASI_Hs01_00013716 predicted 980
14 SASI_Hs01_00013717 predicted 792
15 SASI_Hs01_00013718 predicted 321
16 SASI_Hs01_00013719 predicted 1408
17 SASI_Hs01_00013720 predicted 407
18 SASI_Hs01_00013721 predicted 377
19 SASI_Hs01_00013723 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207999 predicted 1081
2 SASI_Rn02_00208000 predicted 564
3 SASI_Rn02_00208001 predicted 565
4 SASI_Rn02_00208002 predicted 680
5 SASI_Rn02_00208003 predicted 705
6 SASI_Rn02_00208004 predicted 1462
7 SASI_Rn02_00208005 predicted 247
8 SASI_Rn02_00208006 predicted 713
9 SASI_Rn02_00208007 predicted 1188
10 SASI_Rn02_00208008 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154327 predicted 748
2 SASI_Mm02_00333027 predicted 828
3 SASI_Mm02_00333028 predicted 682
4 SASI_Mm01_00154329 predicted 1003
5 SASI_Mm01_00154330 predicted 1463
6 SASI_Mm01_00154331 predicted 369
7 SASI_Mm01_00154332 predicted 759
8 SASI_Mm01_00154334 predicted 1360
9 SASI_Mm01_00154335 predicted 352
10 SASI_Mm01_00154336 predicted 587
11 SASI_Mm01_00154328 predicted 682
12 SASI_Mm01_00154333 predicted 1188
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003465
CHIT1 MISSION shRNA Bacterial Glycerol Stock
chitinase 1 (chitotriosidase)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003465.2-1965s21c1
Sequence:CCGGGACCTTCACGCACGTGTTATTCTCGAGAATAACACGTGCGTGAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003465.2-1486s21c1
Sequence:CCGGACCTGGAATTGAGTCGCTAAACTCGAGTTTAGCGACTCAATTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003465.1-1450s1c1
Sequence:CCGGCCCAGGATCACTCTACAGCCTCTCGAGAGGCTGTAGAGTGATCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003465.1-978s1c1
Sequence:CCGGGCCCTACATCTTCCGGGACAACTCGAGTTGTCCCGGAAGATGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003465.1-1194s1c1
Sequence:CCGGCCCAGAGCTTGAAGTTCCAAACTCGAGTTTGGAACTTCAAGCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003465.1-235s1c1
Sequence:CCGGACTCTCTACCAGGAGTTCAATCTCGAGATTGAACTCCTGGTAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003465.1-380s1c1
Sequence:CCGGCCATCAGGTTTCTGCGCAAATCTCGAGATTTGCGCAGAAACCTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003465
CHIT1 MISSION shRNA shRNA Plasmid DNA
chitinase 1 (chitotriosidase)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003465.2-1965s21c1
Sequence:CCGGGACCTTCACGCACGTGTTATTCTCGAGAATAACACGTGCGTGAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003465.2-1486s21c1
Sequence:CCGGACCTGGAATTGAGTCGCTAAACTCGAGTTTAGCGACTCAATTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003465.1-1450s1c1
Sequence:CCGGCCCAGGATCACTCTACAGCCTCTCGAGAGGCTGTAGAGTGATCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003465.1-978s1c1
Sequence:CCGGGCCCTACATCTTCCGGGACAACTCGAGTTGTCCCGGAAGATGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003465.1-1194s1c1
Sequence:CCGGCCCAGAGCTTGAAGTTCCAAACTCGAGTTTGGAACTTCAAGCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003465.1-235s1c1
Sequence:CCGGACTCTCTACCAGGAGTTCAATCTCGAGATTGAACTCCTGGTAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003465.1-380s1c1
Sequence:CCGGCCATCAGGTTTCTGCGCAAATCTCGAGATTTGCGCAGAAACCTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003465
CHIT1 MISSION shRNA Lentiviral Transduction Particles
chitinase 1 (chitotriosidase)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003465.2-1965s21c1
Sequence:CCGGGACCTTCACGCACGTGTTATTCTCGAGAATAACACGTGCGTGAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003465.2-1486s21c1
Sequence:CCGGACCTGGAATTGAGTCGCTAAACTCGAGTTTAGCGACTCAATTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003465.1-1450s1c1
Sequence:CCGGCCCAGGATCACTCTACAGCCTCTCGAGAGGCTGTAGAGTGATCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003465.1-978s1c1
Sequence:CCGGGCCCTACATCTTCCGGGACAACTCGAGTTGTCCCGGAAGATGTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003465.1-1194s1c1
Sequence:CCGGCCCAGAGCTTGAAGTTCCAAACTCGAGTTTGGAACTTCAAGCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003465.1-235s1c1
Sequence:CCGGACTCTCTACCAGGAGTTCAATCTCGAGATTGAACTCCTGGTAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003465.1-380s1c1
Sequence:CCGGCCATCAGGTTTCTGCGCAAATCTCGAGATTTGCGCAGAAACCTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027979
CHIT1 MISSION shRNA Bacterial Glycerol Stock
chitinase 1 (chitotriosidase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027979.1-581s1c1
Sequence:CCGGCCTTTGTGAAGTCAGCCCTAACTCGAGTTAGGGCTGACTTCACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027979.1-1020s1c1
Sequence:CCGGGCCTACCTATGGACGCTCTTTCTCGAGAAAGAGCGTCCATAGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027979.1-671s1c1
Sequence:CCGGCCACAGTAGACAAAGAGAGATCTCGAGATCTCTCTTTGTCTACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027979.1-1366s1c1
Sequence:CCGGCGGCAGGAACTAAATCTTCCACTCGAGTGGAAGATTTAGTTCCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027979.1-836s1c1
Sequence:CCGGGCTTGGATTTCATCAACCTTACTCGAGTAAGGTTGATGAAATCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027979
CHIT1 MISSION shRNA shRNA Plasmid DNA
chitinase 1 (chitotriosidase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027979.1-581s1c1
Sequence:CCGGCCTTTGTGAAGTCAGCCCTAACTCGAGTTAGGGCTGACTTCACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027979.1-1020s1c1
Sequence:CCGGGCCTACCTATGGACGCTCTTTCTCGAGAAAGAGCGTCCATAGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027979.1-671s1c1
Sequence:CCGGCCACAGTAGACAAAGAGAGATCTCGAGATCTCTCTTTGTCTACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027979.1-1366s1c1
Sequence:CCGGCGGCAGGAACTAAATCTTCCACTCGAGTGGAAGATTTAGTTCCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027979.1-836s1c1
Sequence:CCGGGCTTGGATTTCATCAACCTTACTCGAGTAAGGTTGATGAAATCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027979
CHIT1 MISSION shRNA Lentiviral Transduction Particles
chitinase 1 (chitotriosidase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027979.1-581s1c1
Sequence:CCGGCCTTTGTGAAGTCAGCCCTAACTCGAGTTAGGGCTGACTTCACAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027979.1-1020s1c1
Sequence:CCGGGCCTACCTATGGACGCTCTTTCTCGAGAAAGAGCGTCCATAGGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027979.1-671s1c1
Sequence:CCGGCCACAGTAGACAAAGAGAGATCTCGAGATCTCTCTTTGTCTACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027979.1-1366s1c1
Sequence:CCGGCGGCAGGAACTAAATCTTCCACTCGAGTGGAAGATTTAGTTCCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027979.1-836s1c1
Sequence:CCGGGCTTGGATTTCATCAACCTTACTCGAGTAAGGTTGATGAAATCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)