EMAIL THIS PAGE TO A FRIEND

CHKB

choline kinase beta

179 Gene Product Result for
Synonyms: CHETK CHKL CK CKB CKEKB EK EKB MDCMC
UniProtKB ID: Q9Y259, A0PJM6, Q13388
Gene ID:
Human(1120) Summary: Choline kinase (CK) and ethanolamine kinase (EK) catalyze the phosphorylation of choline/ethanolamine to phosphocholine/phosphoethanolamine. This is the first enzyme in the biosynthesis of phosphatidylcholine/phosphatidylethanolamine in all animal cells. The highly purified CKs from mammalian sources and their recombinant gene products have been shown to have EK activity also, indicating that both activities reside on the same protein. The choline kinase-like protein encoded by CHKL belongs to the choline/ethanolamine kinase family; however, its exact function is not known. Read-through transcripts are expressed from this locus that include exons from the downstream CPT1B locus. [provided by RefSeq, Jun 2009]
Mouse(12651) choline kinase beta
Rat(29367) choline kinase beta
naked mole-rat(101723925) choline kinase beta
domestic guinea pig(100717693) choline kinase beta
sheep(101118779) choline kinase beta
Zebrafish(563589) choline kinase beta
dog(606800) choline kinase beta
cow(536213) choline kinase beta
domestic cat(101083437) choline kinase beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007692 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007692 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007692 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005198 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116671 MISSION® esiRNA esiRNA human CHKB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005198 Rosetta Predictions human pricing
NM_152253 Rosetta Predictions human pricing
NM_017177 Rosetta Predictions rat pricing
NM_007692 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339157 predicted 746
2 SASI_Hs02_00339158 predicted 1030
3 SASI_Hs02_00339159 predicted 1048
4 SASI_Hs02_00339160 predicted 608
5 SASI_Hs02_00339161 predicted 896
6 SASI_Hs02_00339162 predicted 971
7 SASI_Hs02_00339163 predicted 677
8 SASI_Hs02_00339164 predicted 882
9 SASI_Hs02_00339165 predicted 1339
10 SASI_Hs02_00339166 predicted 621
11 SASI_Hs01_00215037 predicted 1220
12 SASI_Hs01_00215038 predicted 1210
13 SASI_Hs01_00215039 predicted 1266
14 SASI_Hs01_00215040 predicted 1159
15 SASI_Hs01_00215041 predicted 1263
16 SASI_Hs01_00215042 predicted 1204
17 SASI_Hs01_00215043 predicted 1261
18 SASI_Hs01_00215044 predicted 1284
19 SASI_Hs01_00215045 predicted 1263
20 SASI_Hs01_00215046 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043169 predicted 743
2 SASI_Hs01_00043170 predicted 251
3 SASI_Hs02_00365751 predicted 2563
4 SASI_Hs01_00043171 predicted 1697
5 SASI_Hs01_00043172 predicted 2758
6 SASI_Hs01_00043173 predicted 4802
7 SASI_Hs01_00043175 predicted 1649
8 SASI_Hs01_00043176 predicted 4103
9 SASI_Hs02_00365752 predicted 2827
10 SASI_Hs01_00043178 predicted 1931
11 SASI_Hs01_00043174 predicted 3111
12 SASI_Hs01_00043177 predicted 2187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017177 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039992 predicted 1376
2 SASI_Rn01_00039993 predicted 1212
3 SASI_Rn01_00039994 predicted 1125
4 SASI_Rn01_00039995 predicted 1397
5 SASI_Rn01_00039996 predicted 646
6 SASI_Rn01_00039999 predicted 914
7 SASI_Rn01_00040000 predicted 414
8 SASI_Rn01_00040001 predicted 1442
9 SASI_Rn02_00261508 predicted 1090
10 SASI_Rn02_00261509 predicted 1137
11 SASI_Rn01_00039997 predicted 908
12 SASI_Rn01_00039998 predicted 1415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116203 predicted 1166
2 SASI_Mm01_00116205 predicted 1113
3 SASI_Mm01_00116206 predicted 1062
4 SASI_Mm01_00116207 predicted 1231
5 SASI_Mm01_00116208 predicted 1401
6 SASI_Mm01_00116209 predicted 917
7 SASI_Mm01_00116210 predicted 632
8 SASI_Mm01_00116211 predicted 816
9 SASI_Mm01_00116212 predicted 1300
10 SASI_Mm02_00312233 predicted 697
11 SASI_Mm01_00116204 predicted 1421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007692
VALIDATED
CHKB MISSION shRNA Bacterial Glycerol Stock
choline kinase beta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007692.5-1144s21c1
Sequence:CCGGGTGAGTGGGTTTATGATTATACTCGAGTATAATCATAAACCCACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007692.5-697s21c1
Sequence:CCGGCCCAGCTTTACGGAGTGTTTCCTCGAGGAAACACTCCGTAAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007692.5-636s21c1
Sequence:CCGGGTAGACTCCTTGGTATTAGAACTCGAGTTCTAATACCAAGGAGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007692.5-1378s21c1
Sequence:CCGGAGGCTTCGATGTCCACTATAGCTCGAGCTATAGTGGACATCGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007692.5-654s21c1
Sequence:CCGGGAAAGCGTGATGTTCGCCATTCTCGAGAATGGCGAACATCACGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007692.2-765s1c1
Sequence:CCGGCAGTGATGATAACCTCATGTTCTCGAGAACATGAGGTTATCATCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007692.2-1014s1c1
Sequence:CCGGGCTGCTAGAGATCAGTCGGTACTCGAGTACCGACTGATCTCTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007692.2-337s1c1
Sequence:CCGGGTAGACTCCTTGGTATTAGAACTCGAGTTCTAATACCAAGGAGTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007692.2-355s1c1
Sequence:CCGGGAAAGCGTGATGTTCGCCATTCTCGAGAATGGCGAACATCACGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007692.2-845s1c1
Sequence:CCGGGTGAGTGGGTTTATGATTATACTCGAGTATAATCATAAACCCACTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007692
VALIDATED
CHKB MISSION shRNA shRNA Plasmid DNA
choline kinase beta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007692.5-1144s21c1
Sequence:CCGGGTGAGTGGGTTTATGATTATACTCGAGTATAATCATAAACCCACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007692.5-697s21c1
Sequence:CCGGCCCAGCTTTACGGAGTGTTTCCTCGAGGAAACACTCCGTAAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007692.5-636s21c1
Sequence:CCGGGTAGACTCCTTGGTATTAGAACTCGAGTTCTAATACCAAGGAGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007692.5-1378s21c1
Sequence:CCGGAGGCTTCGATGTCCACTATAGCTCGAGCTATAGTGGACATCGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007692.5-654s21c1
Sequence:CCGGGAAAGCGTGATGTTCGCCATTCTCGAGAATGGCGAACATCACGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007692.2-765s1c1
Sequence:CCGGCAGTGATGATAACCTCATGTTCTCGAGAACATGAGGTTATCATCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007692.2-1014s1c1
Sequence:CCGGGCTGCTAGAGATCAGTCGGTACTCGAGTACCGACTGATCTCTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007692.2-337s1c1
Sequence:CCGGGTAGACTCCTTGGTATTAGAACTCGAGTTCTAATACCAAGGAGTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007692.2-355s1c1
Sequence:CCGGGAAAGCGTGATGTTCGCCATTCTCGAGAATGGCGAACATCACGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007692.2-845s1c1
Sequence:CCGGGTGAGTGGGTTTATGATTATACTCGAGTATAATCATAAACCCACTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007692
VALIDATED
CHKB MISSION shRNA Lentiviral Transduction Particles
choline kinase beta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007692.5-1144s21c1
Sequence:CCGGGTGAGTGGGTTTATGATTATACTCGAGTATAATCATAAACCCACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007692.5-697s21c1
Sequence:CCGGCCCAGCTTTACGGAGTGTTTCCTCGAGGAAACACTCCGTAAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007692.5-636s21c1
Sequence:CCGGGTAGACTCCTTGGTATTAGAACTCGAGTTCTAATACCAAGGAGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007692.5-1378s21c1
Sequence:CCGGAGGCTTCGATGTCCACTATAGCTCGAGCTATAGTGGACATCGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007692.5-654s21c1
Sequence:CCGGGAAAGCGTGATGTTCGCCATTCTCGAGAATGGCGAACATCACGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007692.2-765s1c1
Sequence:CCGGCAGTGATGATAACCTCATGTTCTCGAGAACATGAGGTTATCATCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007692.2-1014s1c1
Sequence:CCGGGCTGCTAGAGATCAGTCGGTACTCGAGTACCGACTGATCTCTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007692.2-337s1c1
Sequence:CCGGGTAGACTCCTTGGTATTAGAACTCGAGTTCTAATACCAAGGAGTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007692.2-355s1c1
Sequence:CCGGGAAAGCGTGATGTTCGCCATTCTCGAGAATGGCGAACATCACGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007692.2-845s1c1
Sequence:CCGGGTGAGTGGGTTTATGATTATACTCGAGTATAATCATAAACCCACTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005198
CHKB MISSION shRNA Bacterial Glycerol Stock
choline kinase beta
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005198.3-256s1c1
Sequence:CCGGGCAGTCTAAGTGCCCGGACACCTCGAGGTGTCCGGGCACTTAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1199s1c1
Sequence:CCGGCTGGTAGAAGTCAGTCGGTATCTCGAGATACCGACTGACTTCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-856s1c1
Sequence:CCGGCCTCAGGAAGTTACTAGAGTCCTCGAGGACTCTAGTAACTTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-699s1c1
Sequence:CCGGCGCAATTTCATGGCATGGAGACTCGAGTCTCCATGCCATGAAATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1278s1c1
Sequence:CCGGCCATAGAATTTGGTTACTTGGCTCGAGCCAAGTAACCAAATTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1187s1c1
Sequence:CCGGGAAGAAGATTTGCTGGTAGAACTCGAGTTCTACCAGCAAATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1005s1c1
Sequence:CCGGGCTTTGACATTGGGAACCATTCTCGAGAATGGTTCCCAATGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1318s1c1
Sequence:CCGGCCAGTTCTACTTCCAGCAGAACTCGAGTTCTGCTGGAAGTAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1265s1c1
Sequence:CCGGGCATCCATGTCCACCATAGAACTCGAGTTCTATGGTGGACATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-539s1c1
Sequence:CCGGGAAAGCGTGATGTTCGCCATACTCGAGTATGGCGAACATCACGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-686s1c1
Sequence:CCGGGCCACGAAGATGGCGCAATTTCTCGAGAAATTGCGCCATCTTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005198
CHKB MISSION shRNA shRNA Plasmid DNA
choline kinase beta
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005198.3-256s1c1
Sequence:CCGGGCAGTCTAAGTGCCCGGACACCTCGAGGTGTCCGGGCACTTAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1199s1c1
Sequence:CCGGCTGGTAGAAGTCAGTCGGTATCTCGAGATACCGACTGACTTCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-856s1c1
Sequence:CCGGCCTCAGGAAGTTACTAGAGTCCTCGAGGACTCTAGTAACTTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-699s1c1
Sequence:CCGGCGCAATTTCATGGCATGGAGACTCGAGTCTCCATGCCATGAAATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1278s1c1
Sequence:CCGGCCATAGAATTTGGTTACTTGGCTCGAGCCAAGTAACCAAATTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1187s1c1
Sequence:CCGGGAAGAAGATTTGCTGGTAGAACTCGAGTTCTACCAGCAAATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1005s1c1
Sequence:CCGGGCTTTGACATTGGGAACCATTCTCGAGAATGGTTCCCAATGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1318s1c1
Sequence:CCGGCCAGTTCTACTTCCAGCAGAACTCGAGTTCTGCTGGAAGTAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1265s1c1
Sequence:CCGGGCATCCATGTCCACCATAGAACTCGAGTTCTATGGTGGACATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-539s1c1
Sequence:CCGGGAAAGCGTGATGTTCGCCATACTCGAGTATGGCGAACATCACGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-686s1c1
Sequence:CCGGGCCACGAAGATGGCGCAATTTCTCGAGAAATTGCGCCATCTTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005198
CHKB MISSION shRNA Lentiviral Transduction Particles
choline kinase beta
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005198.3-256s1c1
Sequence:CCGGGCAGTCTAAGTGCCCGGACACCTCGAGGTGTCCGGGCACTTAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1199s1c1
Sequence:CCGGCTGGTAGAAGTCAGTCGGTATCTCGAGATACCGACTGACTTCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-856s1c1
Sequence:CCGGCCTCAGGAAGTTACTAGAGTCCTCGAGGACTCTAGTAACTTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-699s1c1
Sequence:CCGGCGCAATTTCATGGCATGGAGACTCGAGTCTCCATGCCATGAAATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1278s1c1
Sequence:CCGGCCATAGAATTTGGTTACTTGGCTCGAGCCAAGTAACCAAATTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1187s1c1
Sequence:CCGGGAAGAAGATTTGCTGGTAGAACTCGAGTTCTACCAGCAAATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1005s1c1
Sequence:CCGGGCTTTGACATTGGGAACCATTCTCGAGAATGGTTCCCAATGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1318s1c1
Sequence:CCGGCCAGTTCTACTTCCAGCAGAACTCGAGTTCTGCTGGAAGTAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-1265s1c1
Sequence:CCGGGCATCCATGTCCACCATAGAACTCGAGTTCTATGGTGGACATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-539s1c1
Sequence:CCGGGAAAGCGTGATGTTCGCCATACTCGAGTATGGCGAACATCACGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005198.3-686s1c1
Sequence:CCGGGCCACGAAGATGGCGCAATTTCTCGAGAAATTGCGCCATCTTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks