EMAIL THIS PAGE TO A FRIEND

CHL1

cell adhesion molecule L1-like

189 Gene Product Result for
Synonyms: CALL L1CAM2
UniProtKB ID: O00533, B7ZL03, Q2M3G2, Q59FY0
Gene ID:
Human(10752) Summary: The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
Mouse(12661) cell adhesion molecule with homology to L1CAM
Rat(89828) cell adhesion molecule L1-like
chicken(416102) cell adhesion molecule with homology to L1CAM (close homolog of L1)
dog(476554) cell adhesion molecule with homology to L1CAM (close homolog of L1)
cow(504415) cell adhesion molecule with homology to L1CAM (close homolog of L1)
Horse(100061158) cell adhesion molecule with homology to L1CAM (close homolog of L1)
sheep(101113017) cell adhesion molecule with homology to L1CAM (close homolog of L1)
Domestic Rabbit(100344766) cell adhesion molecule with homology to L1CAM (close homolog of L1)
naked mole-rat(101698648) cell adhesion molecule with homology to L1CAM (close homolog of L1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1365 Human CHL-1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007697 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007697 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007697 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006614 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006614 Rosetta Predictions human pricing
XM_001077843 Rosetta Predictions rat pricing
NM_007697 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221982 predicted 2104
2 SASI_Hs01_00221983 predicted 3377
3 SASI_Hs02_00341954 predicted 3348
4 SASI_Hs01_00221984 predicted 3548
5 SASI_Hs01_00221985 predicted 2772
6 SASI_Hs02_00341955 predicted 2002
7 SASI_Hs01_00221988 predicted 3769
8 SASI_Hs01_00221989 predicted 1553
9 SASI_Hs02_00341956 predicted 1476
10 SASI_Hs01_00221990 predicted 2737
11 SASI_Hs01_00221986 predicted 1786
12 SASI_Hs01_00221987 predicted 2662
13 SASI_Hs01_00221991 predicted 2060
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358752 predicted 3533
2 SASI_Rn02_00358753 predicted 3156
3 SASI_Rn02_00358754 predicted 3491
4 SASI_Rn02_00358755 predicted 2871
5 SASI_Rn02_00358756 predicted 1488
6 SASI_Rn02_00358757 predicted 2396
7 SASI_Rn02_00358758 predicted 1331
8 SASI_Rn02_00358759 predicted 2311
9 SASI_Rn02_00358760 predicted 2922
10 SASI_Rn02_00358761 predicted 3470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312240 predicted 3321
2 SASI_Mm02_00312241 predicted 3656
3 SASI_Mm02_00312242 predicted 442
4 SASI_Mm02_00312243 predicted 658
5 SASI_Mm02_00312244 predicted 2751
6 SASI_Mm02_00312245 predicted 2262
7 SASI_Mm02_00312246 predicted 671
8 SASI_Mm02_00312247 predicted 905
9 SASI_Mm02_00312248 predicted 2449
10 SASI_Mm02_00312249 predicted 2063
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007697
CHL1 MISSION shRNA Bacterial Glycerol Stock
cell adhesion molecule L1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007697.1-4176s1c1
Sequence:CCGGCCCATTTCAGATACTCCACATCTCGAGATGTGGAGTATCTGAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007697.1-1471s1c1
Sequence:CCGGGCCAAATCATACTGGTGTATACTCGAGTATACACCAGTATGATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007697.1-3779s1c1
Sequence:CCGGGCTGACAGTTTAGTGGAATATCTCGAGATATTCCACTAAACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007697.1-549s1c1
Sequence:CCGGCGGCTAACAATTCAGGCACATCTCGAGATGTGCCTGAATTGTTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007697.1-1016s1c1
Sequence:CCGGCCTGCCCAAATGGGAAGTTTACTCGAGTAAACTTCCCATTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007697
CHL1 MISSION shRNA shRNA Plasmid DNA
cell adhesion molecule L1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007697.1-4176s1c1
Sequence:CCGGCCCATTTCAGATACTCCACATCTCGAGATGTGGAGTATCTGAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007697.1-1471s1c1
Sequence:CCGGGCCAAATCATACTGGTGTATACTCGAGTATACACCAGTATGATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007697.1-3779s1c1
Sequence:CCGGGCTGACAGTTTAGTGGAATATCTCGAGATATTCCACTAAACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007697.1-549s1c1
Sequence:CCGGCGGCTAACAATTCAGGCACATCTCGAGATGTGCCTGAATTGTTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007697.1-1016s1c1
Sequence:CCGGCCTGCCCAAATGGGAAGTTTACTCGAGTAAACTTCCCATTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007697
CHL1 MISSION shRNA Lentiviral Transduction Particles
cell adhesion molecule L1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007697.1-4176s1c1
Sequence:CCGGCCCATTTCAGATACTCCACATCTCGAGATGTGGAGTATCTGAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007697.1-1471s1c1
Sequence:CCGGGCCAAATCATACTGGTGTATACTCGAGTATACACCAGTATGATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007697.1-3779s1c1
Sequence:CCGGGCTGACAGTTTAGTGGAATATCTCGAGATATTCCACTAAACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007697.1-549s1c1
Sequence:CCGGCGGCTAACAATTCAGGCACATCTCGAGATGTGCCTGAATTGTTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007697.1-1016s1c1
Sequence:CCGGCCTGCCCAAATGGGAAGTTTACTCGAGTAAACTTCCCATTTGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006614
CHL1 MISSION shRNA Bacterial Glycerol Stock
cell adhesion molecule L1-like
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006614.2-5626s1c1
Sequence:CCGGCCAGAATGTATAGACAGGAAACTCGAGTTTCCTGTCTATACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006614.2-866s1c1
Sequence:CCGGCGCAATGACTACTGTTGCTTTCTCGAGAAAGCAACAGTAGTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006614.2-2117s1c1
Sequence:CCGGGCTGCCGATATAACTCAAGTACTCGAGTACTTGAGTTATATCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006614.2-1583s1c1
Sequence:CCGGCGTCCATTGATACAAACCAAACTCGAGTTTGGTTTGTATCAATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006614.2-1586s1c1
Sequence:CCGGCCATTGATACAAACCAAAGATCTCGAGATCTTTGGTTTGTATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006614.2-2236s21c1
Sequence:CCGGCAGCAATATTAGCGAGTATATCTCGAGATATACTCGCTAATATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006614
CHL1 MISSION shRNA shRNA Plasmid DNA
cell adhesion molecule L1-like
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006614.2-5626s1c1
Sequence:CCGGCCAGAATGTATAGACAGGAAACTCGAGTTTCCTGTCTATACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006614.2-866s1c1
Sequence:CCGGCGCAATGACTACTGTTGCTTTCTCGAGAAAGCAACAGTAGTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006614.2-2117s1c1
Sequence:CCGGGCTGCCGATATAACTCAAGTACTCGAGTACTTGAGTTATATCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006614.2-1583s1c1
Sequence:CCGGCGTCCATTGATACAAACCAAACTCGAGTTTGGTTTGTATCAATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006614.2-1586s1c1
Sequence:CCGGCCATTGATACAAACCAAAGATCTCGAGATCTTTGGTTTGTATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006614.2-2236s21c1
Sequence:CCGGCAGCAATATTAGCGAGTATATCTCGAGATATACTCGCTAATATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006614
CHL1 MISSION shRNA Lentiviral Transduction Particles
cell adhesion molecule L1-like
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006614.2-5626s1c1
Sequence:CCGGCCAGAATGTATAGACAGGAAACTCGAGTTTCCTGTCTATACATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006614.2-866s1c1
Sequence:CCGGCGCAATGACTACTGTTGCTTTCTCGAGAAAGCAACAGTAGTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006614.2-2117s1c1
Sequence:CCGGGCTGCCGATATAACTCAAGTACTCGAGTACTTGAGTTATATCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006614.2-1583s1c1
Sequence:CCGGCGTCCATTGATACAAACCAAACTCGAGTTTGGTTTGTATCAATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006614.2-1586s1c1
Sequence:CCGGCCATTGATACAAACCAAAGATCTCGAGATCTTTGGTTTGTATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006614.2-2236s21c1
Sequence:CCGGCAGCAATATTAGCGAGTATATCTCGAGATATACTCGCTAATATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks