EMAIL THIS PAGE TO A FRIEND

CHM

choroideremia (Rab escort protein 1)

62 Gene Product Result for
Synonyms: DXS540 GGTA HSD-32 REP-1 TCD
UniProtKB ID: P24386, A1L4D2, O43732
Gene ID:
Human(1121) Summary: This gene encodes component A of the RAB geranylgeranyl transferase holoenzyme. In the dimeric holoenzyme, this subunit binds unprenylated Rab GTPases and then presents them to the catalytic Rab GGTase subunit for the geranylgeranyl transfer reaction. Rab GTPases need to be geranylgeranyled on either one or two cysteine residues in their C-terminus to localize to the correct intracellular membrane. Mutations in this gene are a cause of choroideremia; also known as tapetochoroidal dystrophy (TCD). This X-linked disease is characterized by progressive dystrophy of the choroid, retinal pigment epithelium and retina. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2009]
Mouse(12662) choroidermia
Rat(24942) choroideremia (Rab escort protein 1)
naked mole-rat(101697357) choroideremia (Rab escort protein 1)
domestic guinea pig(100728618) choroideremia (Rab escort protein 1)
sheep(101102290) choroideremia (Rab escort protein 1)
Zebrafish(402935) choroideremia (Rab escort protein 1)
chicken(422266) choroideremia (Rab escort protein 1)
dog(480972) choroideremia (Rab escort protein 1)
domestic cat(101095320) choroideremia (Rab escort protein 1)
Horse(100072281) choroideremia (Rab escort protein 1)
cow(519552) choroideremia (Rab escort protein 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018818 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018818 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018818 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000390 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000390 Rosetta Predictions human pricing
NM_001037312 Rosetta Predictions human pricing
NM_017067 Rosetta Predictions rat pricing
NM_018818 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101897 predicted 767
2 SASI_Hs01_00101898 predicted 1868
3 SASI_Hs01_00101899 predicted 2005
4 SASI_Hs01_00101900 predicted 779
5 SASI_Hs02_00302459 predicted 734
6 SASI_Hs01_00101901 predicted 880
7 SASI_Hs02_00302460 predicted 287
8 SASI_Hs01_00101903 predicted 1986
9 SASI_Hs01_00101904 predicted 1665
10 SASI_Hs01_00101905 predicted 1493
11 SASI_Hs01_00101902 predicted 1858
12 SASI_Hs01_00101906 predicted 2082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204168 predicted 750
2 SASI_Hs01_00204169 predicted 288
3 SASI_Hs01_00204170 predicted 48
4 SASI_Hs01_00204171 predicted 251
5 SASI_Hs01_00204172 predicted 233
6 SASI_Hs01_00204173 predicted 40
7 SASI_Hs01_00204174 predicted 129
8 SASI_Hs01_00204175 predicted 289
9 SASI_Hs01_00204176 predicted 777
10 SASI_Hs01_00204177 predicted 191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017067 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095751 predicted 1028
2 SASI_Rn01_00095752 predicted 635
3 SASI_Rn01_00095754 predicted 1691
4 SASI_Rn01_00095755 predicted 842
5 SASI_Rn01_00095756 predicted 1248
6 SASI_Rn01_00095757 predicted 1175
7 SASI_Rn01_00095758 predicted 1568
8 SASI_Rn01_00095760 predicted 279
9 SASI_Rn02_00261270 predicted 1491
10 SASI_Rn02_00261271 predicted 710
11 SASI_Rn01_00095753 predicted 931
12 SASI_Rn01_00095759 predicted 1956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018818 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097702 predicted 903
2 SASI_Mm01_00097703 predicted 1907
3 SASI_Mm01_00097704 predicted 1420
4 SASI_Mm01_00097706 predicted 1351
5 SASI_Mm01_00097707 predicted 932
6 SASI_Mm01_00097708 predicted 1728
7 SASI_Mm02_00324159 predicted 1877
8 SASI_Mm01_00097710 predicted 1242
9 SASI_Mm02_00324160 predicted 718
10 SASI_Mm01_00097711 predicted 693
11 SASI_Mm01_00097705 predicted 731
12 SASI_Mm01_00097709 predicted 2036
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018818
VALIDATED
CHM MISSION shRNA Bacterial Glycerol Stock
choroideremia (Rab escort protein 1)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018818.2-724s21c1
Sequence:CCGGGCCGAAGATTTAACATTGATTCTCGAGAATCAATGTTAAATCTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018818.2-1625s21c1
Sequence:CCGGCCAGAAATTGTTTACTCCATACTCGAGTATGGAGTAAACAATTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018818.2-570s21c1
Sequence:CCGGCCACAAGTAAATGATGCTGAACTCGAGTTCAGCATCATTTACTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303210    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018818.2-3357s21c1
Sequence:CCGGGCCAGGTTTCAGCGATGTTAACTCGAGTTAACATCGCTGAAACCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018818.1-3362s1c1
Sequence:CCGGGCCAGGTTTCAGCGATGTTAACTCGAGTTAACATCGCTGAAACCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018818.1-579s1c1
Sequence:CCGGCCACAAGTAAATGATGCTGAACTCGAGTTCAGCATCATTTACTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018818.1-1634s1c1
Sequence:CCGGCCAGAAATTGTTTACTCCATACTCGAGTATGGAGTAAACAATTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018818.1-733s1c1
Sequence:CCGGGCCGAAGATTTAACATTGATTCTCGAGAATCAATGTTAAATCTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018818.1-1794s1c1
Sequence:CCGGCCTGACTGTAATCTAGGAAATCTCGAGATTTCCTAGATTACAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018818
VALIDATED
CHM MISSION shRNA shRNA Plasmid DNA
choroideremia (Rab escort protein 1)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018818.2-724s21c1
Sequence:CCGGGCCGAAGATTTAACATTGATTCTCGAGAATCAATGTTAAATCTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018818.2-1625s21c1
Sequence:CCGGCCAGAAATTGTTTACTCCATACTCGAGTATGGAGTAAACAATTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018818.2-570s21c1
Sequence:CCGGCCACAAGTAAATGATGCTGAACTCGAGTTCAGCATCATTTACTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303210    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018818.2-3357s21c1
Sequence:CCGGGCCAGGTTTCAGCGATGTTAACTCGAGTTAACATCGCTGAAACCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018818.1-3362s1c1
Sequence:CCGGGCCAGGTTTCAGCGATGTTAACTCGAGTTAACATCGCTGAAACCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018818.1-579s1c1
Sequence:CCGGCCACAAGTAAATGATGCTGAACTCGAGTTCAGCATCATTTACTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018818.1-1634s1c1
Sequence:CCGGCCAGAAATTGTTTACTCCATACTCGAGTATGGAGTAAACAATTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018818.1-733s1c1
Sequence:CCGGGCCGAAGATTTAACATTGATTCTCGAGAATCAATGTTAAATCTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018818.1-1794s1c1
Sequence:CCGGCCTGACTGTAATCTAGGAAATCTCGAGATTTCCTAGATTACAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018818
VALIDATED
CHM MISSION shRNA Lentiviral Transduction Particles
choroideremia (Rab escort protein 1)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018818.2-724s21c1
Sequence:CCGGGCCGAAGATTTAACATTGATTCTCGAGAATCAATGTTAAATCTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018818.2-1625s21c1
Sequence:CCGGCCAGAAATTGTTTACTCCATACTCGAGTATGGAGTAAACAATTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018818.2-570s21c1
Sequence:CCGGCCACAAGTAAATGATGCTGAACTCGAGTTCAGCATCATTTACTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303210    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018818.2-3357s21c1
Sequence:CCGGGCCAGGTTTCAGCGATGTTAACTCGAGTTAACATCGCTGAAACCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018818.1-3362s1c1
Sequence:CCGGGCCAGGTTTCAGCGATGTTAACTCGAGTTAACATCGCTGAAACCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018818.1-579s1c1
Sequence:CCGGCCACAAGTAAATGATGCTGAACTCGAGTTCAGCATCATTTACTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018818.1-1634s1c1
Sequence:CCGGCCAGAAATTGTTTACTCCATACTCGAGTATGGAGTAAACAATTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018818.1-733s1c1
Sequence:CCGGGCCGAAGATTTAACATTGATTCTCGAGAATCAATGTTAAATCTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018818.1-1794s1c1
Sequence:CCGGCCTGACTGTAATCTAGGAAATCTCGAGATTTCCTAGATTACAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000390
VALIDATED
CHM MISSION shRNA Bacterial Glycerol Stock
choroideremia (Rab escort protein 1)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000390.2-970s21c1
Sequence:CCGGGGATATGAAGAGATCACATTTCTCGAGAAATGTGATCTCTTCATATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000390.2-1729s21c1
Sequence:CCGGGATTTACCATCCAACGTTTATCTCGAGATAAACGTTGGATGGTAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000390.2-2800s21c1
Sequence:CCGGGCCTACGTTTCTCCATATATACTCGAGTATATATGGAGAAACGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000390.2-1524s21c1
Sequence:CCGGATGCATGAAAGGCACCTATTTCTCGAGAAATAGGTGCCTTTCATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000390.2-448s21c1
Sequence:CCGGCCTACGGAGGATGAGTCATTACTCGAGTAATGACTCATCCTCCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000390.1-1129s1c1
Sequence:CCGGCGGTATGGCAACACTCCATTTCTCGAGAAATGGAGTGTTGCCATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_000390.1-1618s1c1
Sequence:CCGGCCATATACTGAAATGGAGATACTCGAGTATCTCCATTTCAGTATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000390.1-63s1c1
Sequence:CCGGGATCGTAATAGGGACGGGTTTCTCGAGAAACCCGTCCCTATTACGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000390.1-1760s1c1
Sequence:CCGGGCCCAGATTGTGGTTTAGGAACTCGAGTTCCTAAACCACAATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_000390.1-517s1c1
Sequence:CCGGCCAGAGAATGCGCTAGAAGTACTCGAGTACTTCTAGCGCATTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000390
VALIDATED
CHM MISSION shRNA shRNA Plasmid DNA
choroideremia (Rab escort protein 1)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000390.2-970s21c1
Sequence:CCGGGGATATGAAGAGATCACATTTCTCGAGAAATGTGATCTCTTCATATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000390.2-1729s21c1
Sequence:CCGGGATTTACCATCCAACGTTTATCTCGAGATAAACGTTGGATGGTAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000390.2-2800s21c1
Sequence:CCGGGCCTACGTTTCTCCATATATACTCGAGTATATATGGAGAAACGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000390.2-1524s21c1
Sequence:CCGGATGCATGAAAGGCACCTATTTCTCGAGAAATAGGTGCCTTTCATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000390.2-448s21c1
Sequence:CCGGCCTACGGAGGATGAGTCATTACTCGAGTAATGACTCATCCTCCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000390.1-1129s1c1
Sequence:CCGGCGGTATGGCAACACTCCATTTCTCGAGAAATGGAGTGTTGCCATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_000390.1-1618s1c1
Sequence:CCGGCCATATACTGAAATGGAGATACTCGAGTATCTCCATTTCAGTATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000390.1-63s1c1
Sequence:CCGGGATCGTAATAGGGACGGGTTTCTCGAGAAACCCGTCCCTATTACGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000390.1-1760s1c1
Sequence:CCGGGCCCAGATTGTGGTTTAGGAACTCGAGTTCCTAAACCACAATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_000390.1-517s1c1
Sequence:CCGGCCAGAGAATGCGCTAGAAGTACTCGAGTACTTCTAGCGCATTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000390
VALIDATED
CHM MISSION shRNA Lentiviral Transduction Particles
choroideremia (Rab escort protein 1)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000390.2-970s21c1
Sequence:CCGGGGATATGAAGAGATCACATTTCTCGAGAAATGTGATCTCTTCATATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000390.2-1729s21c1
Sequence:CCGGGATTTACCATCCAACGTTTATCTCGAGATAAACGTTGGATGGTAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000390.2-2800s21c1
Sequence:CCGGGCCTACGTTTCTCCATATATACTCGAGTATATATGGAGAAACGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000390.2-1524s21c1
Sequence:CCGGATGCATGAAAGGCACCTATTTCTCGAGAAATAGGTGCCTTTCATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000390.2-448s21c1
Sequence:CCGGCCTACGGAGGATGAGTCATTACTCGAGTAATGACTCATCCTCCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000390.1-1129s1c1
Sequence:CCGGCGGTATGGCAACACTCCATTTCTCGAGAAATGGAGTGTTGCCATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_000390.1-1618s1c1
Sequence:CCGGCCATATACTGAAATGGAGATACTCGAGTATCTCCATTTCAGTATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000390.1-63s1c1
Sequence:CCGGGATCGTAATAGGGACGGGTTTCTCGAGAAACCCGTCCCTATTACGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000390.1-1760s1c1
Sequence:CCGGGCCCAGATTGTGGTTTAGGAACTCGAGTTCCTAAACCACAATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_000390.1-517s1c1
Sequence:CCGGCCAGAGAATGCGCTAGAAGTACTCGAGTACTTCTAGCGCATTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)