EMAIL THIS PAGE TO A FRIEND

CHML

choroideremia-like (Rab escort protein 2)

90 Gene Product Result for
Synonyms: REP2
UniProtKB ID: P26374, B2RAB9, Q17RE0, Q9H1Y4
Gene ID:
Human(1122) Summary: The product of the CHML gene supports geranylgeranylation of most Rab proteins and may substitute for REP-1 in tissues other than retina. CHML is localized close to the gene for Usher syndrome type II. [provided by RefSeq, Jul 2008]
Mouse(12663) choroideremia-like
Rat(689102) choroideremia-like (Rab escort protein 2)
sheep(101120764) choroideremia-like (Rab escort protein 2)
Domestic Rabbit(100358631) choroideremia-like (Rab escort protein 2)
domestic guinea pig(101788108) choroideremia-like (Rab escort protein 2)
naked mole-rat(101716741) choroideremia-like (Rab escort protein 2)
domestic cat(101093826) choroideremia-like (Rab escort protein 2)
cow(532324) choroideremia-like (Rab escort protein 2)
Horse(100054779) choroideremia-like (Rab escort protein 2)
dog(480094) choroideremia-like (Rab escort protein 2)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021350 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021350 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021350 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001821 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001821 Rosetta Predictions human pricing
NM_001109524 Rosetta Predictions rat pricing
NM_021350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332604 predicted 1391
2 SASI_Hs01_00219524 predicted 902
3 SASI_Hs01_00219525 predicted 1926
4 SASI_Hs01_00219526 predicted 1841
5 SASI_Hs02_00332605 predicted 1789
6 SASI_Hs01_00219528 predicted 1740
7 SASI_Hs02_00332606 predicted 1684
8 SASI_Hs01_00219529 predicted 1533
9 SASI_Hs01_00219530 predicted 808
10 SASI_Hs01_00219531 predicted 939
11 SASI_Hs01_00219522 predicted 2221
12 SASI_Hs01_00219523 predicted 923
13 SASI_Hs01_00219527 predicted 1509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249249 predicted 1035
2 SASI_Rn02_00249250 predicted 1275
3 SASI_Rn02_00249251 predicted 720
4 SASI_Rn02_00249252 predicted 1148
5 SASI_Rn02_00249253 predicted 1327
6 SASI_Rn02_00249254 predicted 1108
7 SASI_Rn02_00249255 predicted 1184
8 SASI_Rn02_00249256 predicted 737
9 SASI_Rn02_00249257 predicted 1466
10 SASI_Rn02_00249258 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171411 predicted 445
2 SASI_Mm01_00171412 predicted 626
3 SASI_Mm02_00325931 predicted 1853
4 SASI_Mm01_00171414 predicted 261
5 SASI_Mm02_00325932 predicted 908
6 SASI_Mm01_00171415 predicted 1283
7 SASI_Mm02_00325933 predicted 1927
8 SASI_Mm01_00171416 predicted 1606
9 SASI_Mm01_00171418 predicted 1278
10 SASI_Mm01_00171419 predicted 883
11 SASI_Mm01_00171413 predicted 829
12 SASI_Mm01_00171417 predicted 778
13 SASI_Mm01_00171420 predicted 1244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021350
CHML MISSION shRNA Bacterial Glycerol Stock
choroideremia-like (Rab escort protein 2)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021350.1-1204s1c1
Sequence:CCGGCGCCATAAAGTACAATGCCTTCTCGAGAAGGCATTGTACTTTATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021350.1-675s1c1
Sequence:CCGGCCGGAGATTTAATATTGACTTCTCGAGAAGTCAATATTAAATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021350.1-1051s1c1
Sequence:CCGGCCTACATTAGATGGCCTTCAACTCGAGTTGAAGGCCATCTAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021350.1-1700s1c1
Sequence:CCGGGTGGCTTACCTTCCAATGTATCTCGAGATACATTGGAAGGTAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021350.1-1687s1c1
Sequence:CCGGCGAAGCTCATACTGTGGCTTACTCGAGTAAGCCACAGTATGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021350.2-695s21c1
Sequence:GTACCGGTGGTATCAAAGCCGCTGTATTCTCGAGAATACAGCGGCTTTGATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021350.2-2319s21c1
Sequence:GTACCGGACAATGCCCAAGGACTATTATCTCGAGATAATAGTCCTTGGGCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021350.2-1192s21c1
Sequence:GTACCGGGTCTATTGTCTTCGCCATAAACTCGAGTTTATGGCGAAGACAATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021350
CHML MISSION shRNA shRNA Plasmid DNA
choroideremia-like (Rab escort protein 2)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021350.1-1204s1c1
Sequence:CCGGCGCCATAAAGTACAATGCCTTCTCGAGAAGGCATTGTACTTTATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021350.1-675s1c1
Sequence:CCGGCCGGAGATTTAATATTGACTTCTCGAGAAGTCAATATTAAATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021350.1-1051s1c1
Sequence:CCGGCCTACATTAGATGGCCTTCAACTCGAGTTGAAGGCCATCTAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021350.1-1700s1c1
Sequence:CCGGGTGGCTTACCTTCCAATGTATCTCGAGATACATTGGAAGGTAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021350.1-1687s1c1
Sequence:CCGGCGAAGCTCATACTGTGGCTTACTCGAGTAAGCCACAGTATGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021350.2-695s21c1
Sequence:GTACCGGTGGTATCAAAGCCGCTGTATTCTCGAGAATACAGCGGCTTTGATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021350.2-2319s21c1
Sequence:GTACCGGACAATGCCCAAGGACTATTATCTCGAGATAATAGTCCTTGGGCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021350.2-1192s21c1
Sequence:GTACCGGGTCTATTGTCTTCGCCATAAACTCGAGTTTATGGCGAAGACAATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021350
CHML MISSION shRNA Lentiviral Transduction Particles
choroideremia-like (Rab escort protein 2)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021350.1-1204s1c1
Sequence:CCGGCGCCATAAAGTACAATGCCTTCTCGAGAAGGCATTGTACTTTATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021350.1-675s1c1
Sequence:CCGGCCGGAGATTTAATATTGACTTCTCGAGAAGTCAATATTAAATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021350.1-1051s1c1
Sequence:CCGGCCTACATTAGATGGCCTTCAACTCGAGTTGAAGGCCATCTAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021350.1-1700s1c1
Sequence:CCGGGTGGCTTACCTTCCAATGTATCTCGAGATACATTGGAAGGTAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021350.1-1687s1c1
Sequence:CCGGCGAAGCTCATACTGTGGCTTACTCGAGTAAGCCACAGTATGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021350.2-695s21c1
Sequence:GTACCGGTGGTATCAAAGCCGCTGTATTCTCGAGAATACAGCGGCTTTGATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021350.2-2319s21c1
Sequence:GTACCGGACAATGCCCAAGGACTATTATCTCGAGATAATAGTCCTTGGGCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021350.2-1192s21c1
Sequence:GTACCGGGTCTATTGTCTTCGCCATAAACTCGAGTTTATGGCGAAGACAATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001821
CHML MISSION shRNA Bacterial Glycerol Stock
choroideremia-like (Rab escort protein 2)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001821.2-5591s1c1
Sequence:CCGGGCCTAAATAGAAGCAAGTTTACTCGAGTAAACTTGCTTCTATTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001821.2-1371s1c1
Sequence:CCGGCGTCATAAAGTACAATGCTTTCTCGAGAAAGCATTGTACTTTATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001821.2-432s1c1
Sequence:CCGGCGCAAGAAGGATGAAACTATTCTCGAGAATAGTTTCATCCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001821.2-1216s1c1
Sequence:CCGGGCACTACAATAGATGGTCTTACTCGAGTAAGACCATCTATTGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001821.3-785s21c1
Sequence:GTACCGGTAAGGCCGATGAACCAATTAGCTCGAGCTAATTGGTTCATCGGCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001821.3-1411s21c1
Sequence:GTACCGGGACGATGTAAAGCAATTATAGCTCGAGCTATAATTGCTTTACATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001821.3-1227s21c1
Sequence:GTACCGGGATGGTCTTAACGCAACTAAACTCGAGTTTAGTTGCGTTAAGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001821.3-587s21c1
Sequence:GTACCGGAGAAAGCCAGTTATCGTATTTCTCGAGAAATACGATAACTGGCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001821
CHML MISSION shRNA shRNA Plasmid DNA
choroideremia-like (Rab escort protein 2)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001821.2-5591s1c1
Sequence:CCGGGCCTAAATAGAAGCAAGTTTACTCGAGTAAACTTGCTTCTATTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001821.2-1371s1c1
Sequence:CCGGCGTCATAAAGTACAATGCTTTCTCGAGAAAGCATTGTACTTTATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001821.2-432s1c1
Sequence:CCGGCGCAAGAAGGATGAAACTATTCTCGAGAATAGTTTCATCCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001821.2-1216s1c1
Sequence:CCGGGCACTACAATAGATGGTCTTACTCGAGTAAGACCATCTATTGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001821.3-785s21c1
Sequence:GTACCGGTAAGGCCGATGAACCAATTAGCTCGAGCTAATTGGTTCATCGGCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001821.3-1411s21c1
Sequence:GTACCGGGACGATGTAAAGCAATTATAGCTCGAGCTATAATTGCTTTACATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001821.3-1227s21c1
Sequence:GTACCGGGATGGTCTTAACGCAACTAAACTCGAGTTTAGTTGCGTTAAGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001821.3-587s21c1
Sequence:GTACCGGAGAAAGCCAGTTATCGTATTTCTCGAGAAATACGATAACTGGCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001821
CHML MISSION shRNA Lentiviral Transduction Particles
choroideremia-like (Rab escort protein 2)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001821.2-5591s1c1
Sequence:CCGGGCCTAAATAGAAGCAAGTTTACTCGAGTAAACTTGCTTCTATTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001821.2-1371s1c1
Sequence:CCGGCGTCATAAAGTACAATGCTTTCTCGAGAAAGCATTGTACTTTATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001821.2-432s1c1
Sequence:CCGGCGCAAGAAGGATGAAACTATTCTCGAGAATAGTTTCATCCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001821.2-1216s1c1
Sequence:CCGGGCACTACAATAGATGGTCTTACTCGAGTAAGACCATCTATTGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001821.3-785s21c1
Sequence:GTACCGGTAAGGCCGATGAACCAATTAGCTCGAGCTAATTGGTTCATCGGCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001821.3-1411s21c1
Sequence:GTACCGGGACGATGTAAAGCAATTATAGCTCGAGCTATAATTGCTTTACATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001821.3-1227s21c1
Sequence:GTACCGGGATGGTCTTAACGCAACTAAACTCGAGTTTAGTTGCGTTAAGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001821.3-587s21c1
Sequence:GTACCGGAGAAAGCCAGTTATCGTATTTCTCGAGAAATACGATAACTGGCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks