EMAIL THIS PAGE TO A FRIEND

CHMP1A

charged multivesicular body protein 1A

66 Gene Product Result for
Synonyms: CHMP1 PCH8 PCOLN3 PRSM1 VPS46-1 VPS46A
UniProtKB ID: Q9HD42, A2RU09, Q14468, Q15779, Q96G31
Gene ID:
Human(5119) Summary: This gene encodes a member of the CHMP/Chmp family of proteins which are involved in multivesicular body sorting of proteins to the interiors of lysosomes. The initial prediction of the protein sequence encoded by this gene suggested that the encoded protein was a metallopeptidase. The nomenclature has been updated recently to reflect the correct biological function of this encoded protein. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(234852) charged multivesicular body protein 1A
Rat(365024) charged multivesicular body protein 1A
Zebrafish(393535) chromatin modifying protein 1A
cow(789414) chromatin modifying protein 1A
domestic cat(101082965) charged multivesicular body protein 1A
dog(489656) charged multivesicular body protein 1A
chicken(415841) chromatin modifying protein 1A
naked mole-rat(101702278) charged multivesicular body protein 1A
domestic guinea pig(100731505) charged multivesicular body protein 1A
sheep(101111221) charged multivesicular body protein 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145606 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145606 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145606 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001083314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001083314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001083314 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083314 Rosetta Predictions human pricing
NM_002768 Rosetta Predictions human pricing
NM_001083313 Rosetta Predictions rat pricing
NM_145606 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316900 predicted 883
2 SASI_Hs02_00316901 predicted 1352
3 SASI_Hs02_00316902 predicted 1351
4 SASI_Hs02_00316903 predicted 1016
5 SASI_Hs02_00316904 predicted 845
6 SASI_Hs02_00316905 predicted 469
7 SASI_Hs02_00316906 predicted 1201
8 SASI_Hs02_00316907 predicted 421
9 SASI_Hs02_00316908 predicted 490
10 SASI_Hs02_00316909 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188302 predicted 904
2 SASI_Hs01_00188305 predicted 1042
3 SASI_Hs01_00188306 predicted 866
4 SASI_Hs02_00334391 predicted 914
5 SASI_Hs02_00334392 predicted 862
6 SASI_Hs01_00188307 predicted 486
7 SASI_Hs01_00188308 predicted 1224
8 SASI_Hs02_00334393 predicted 903
9 SASI_Hs01_00188309 predicted 441
10 SASI_Hs02_00334394 predicted 508
11 SASI_Hs01_00188301 predicted 396
12 SASI_Hs01_00188303 predicted 1496
13 SASI_Hs01_00188304 predicted 425
14 SASI_Hs01_00188310 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208849 predicted 1098
2 SASI_Rn02_00208850 predicted 771
3 SASI_Rn02_00208851 predicted 1076
4 SASI_Rn02_00208852 predicted 240
5 SASI_Rn02_00208853 predicted 833
6 SASI_Rn02_00208854 predicted 323
7 SASI_Rn02_00208855 predicted 776
8 SASI_Rn02_00208856 predicted 412
9 SASI_Rn02_00208857 predicted 828
10 SASI_Rn02_00208858 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341158 predicted 673
2 SASI_Mm02_00341159 predicted 912
3 SASI_Mm02_00341160 predicted 682
4 SASI_Mm02_00341161 predicted 701
5 SASI_Mm02_00341162 predicted 1095
6 SASI_Mm01_00073263 predicted 1022
7 SASI_Mm02_00341163 predicted 320
8 SASI_Mm01_00073264 predicted 815
9 SASI_Mm01_00073265 predicted 429
10 SASI_Mm02_00341164 predicted 806
11 SASI_Mm01_00073258 predicted 1088
12 SASI_Mm01_00073259 predicted 707
13 SASI_Mm01_00073260 predicted 233
14 SASI_Mm01_00073261 predicted 777
15 SASI_Mm01_00073262 predicted 812
16 SASI_Mm01_00073266 predicted 741
17 SASI_Mm01_00073267 predicted 773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145606
CHMP1A MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 1A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145606.3-1888s21c1
Sequence:CCGGCCACATTACAAGTTGATGTTACTCGAGTAACATCAACTTGTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145606.3-490s21c1
Sequence:CCGGACACATCGGTAATGGAGGATTCTCGAGAATCCTCCATTACCGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145606.3-207s21c1
Sequence:CCGGGCCAAAGTGAAGAAGGCCCTTCTCGAGAAGGGCCTTCTTCACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145606.3-276s21c1
Sequence:CCGGCGCAAGAAGAATGAAGGTGTACTCGAGTACACCTTCATTCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145606.3-555s21c1
Sequence:CCGGGACAGCCTCATTGTCCAGATACTCGAGTATCTGGACAATGAGGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145606.1-1839s1c1
Sequence:CCGGCCACATTACAAGTTGATGTTACTCGAGTAACATCAACTTGTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145606.1-505s1c1
Sequence:CCGGGACAGCCTCATTGTCCAGATACTCGAGTATCTGGACAATGAGGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145606.1-157s1c1
Sequence:CCGGGCCAAAGTGAAGAAGGCCCTTCTCGAGAAGGGCCTTCTTCACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145606.1-440s1c1
Sequence:CCGGACACATCGGTAATGGAGGATTCTCGAGAATCCTCCATTACCGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145606.1-226s1c1
Sequence:CCGGCGCAAGAAGAATGAAGGTGTACTCGAGTACACCTTCATTCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145606
CHMP1A MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 1A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145606.3-1888s21c1
Sequence:CCGGCCACATTACAAGTTGATGTTACTCGAGTAACATCAACTTGTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145606.3-490s21c1
Sequence:CCGGACACATCGGTAATGGAGGATTCTCGAGAATCCTCCATTACCGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145606.3-207s21c1
Sequence:CCGGGCCAAAGTGAAGAAGGCCCTTCTCGAGAAGGGCCTTCTTCACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145606.3-276s21c1
Sequence:CCGGCGCAAGAAGAATGAAGGTGTACTCGAGTACACCTTCATTCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145606.3-555s21c1
Sequence:CCGGGACAGCCTCATTGTCCAGATACTCGAGTATCTGGACAATGAGGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145606.1-1839s1c1
Sequence:CCGGCCACATTACAAGTTGATGTTACTCGAGTAACATCAACTTGTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145606.1-505s1c1
Sequence:CCGGGACAGCCTCATTGTCCAGATACTCGAGTATCTGGACAATGAGGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145606.1-157s1c1
Sequence:CCGGGCCAAAGTGAAGAAGGCCCTTCTCGAGAAGGGCCTTCTTCACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145606.1-440s1c1
Sequence:CCGGACACATCGGTAATGGAGGATTCTCGAGAATCCTCCATTACCGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145606.1-226s1c1
Sequence:CCGGCGCAAGAAGAATGAAGGTGTACTCGAGTACACCTTCATTCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145606
CHMP1A MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 1A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145606.3-1888s21c1
Sequence:CCGGCCACATTACAAGTTGATGTTACTCGAGTAACATCAACTTGTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145606.3-490s21c1
Sequence:CCGGACACATCGGTAATGGAGGATTCTCGAGAATCCTCCATTACCGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145606.3-207s21c1
Sequence:CCGGGCCAAAGTGAAGAAGGCCCTTCTCGAGAAGGGCCTTCTTCACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145606.3-276s21c1
Sequence:CCGGCGCAAGAAGAATGAAGGTGTACTCGAGTACACCTTCATTCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145606.3-555s21c1
Sequence:CCGGGACAGCCTCATTGTCCAGATACTCGAGTATCTGGACAATGAGGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145606.1-1839s1c1
Sequence:CCGGCCACATTACAAGTTGATGTTACTCGAGTAACATCAACTTGTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145606.1-505s1c1
Sequence:CCGGGACAGCCTCATTGTCCAGATACTCGAGTATCTGGACAATGAGGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145606.1-157s1c1
Sequence:CCGGGCCAAAGTGAAGAAGGCCCTTCTCGAGAAGGGCCTTCTTCACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145606.1-440s1c1
Sequence:CCGGACACATCGGTAATGGAGGATTCTCGAGAATCCTCCATTACCGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145606.1-226s1c1
Sequence:CCGGCGCAAGAAGAATGAAGGTGTACTCGAGTACACCTTCATTCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001083314
CHMP1A MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 1A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083314.1-237s21c1
Sequence:CCGGGTAGAGTGTGCCCGTGTGTATCTCGAGATACACACGGGCACACTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083314.1-1194s21c1
Sequence:CCGGCAACGCTGTCCTGGTGGTATTCTCGAGAATACCACCAGGACAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083314.1-472s21c1
Sequence:CCGGAGAACCTGGACGTCCATACATCTCGAGATGTATGGACGTCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083314.1-262s21c1
Sequence:CCGGAGAACGCCATCCGCAAGAAGACTCGAGTCTTCTTGCGGATGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083314.1-339s21c1
Sequence:CCGGGTGCAGACAGCTGTGACTATGCTCGAGCATAGTCACAGCTGTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001083314
CHMP1A MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 1A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083314.1-237s21c1
Sequence:CCGGGTAGAGTGTGCCCGTGTGTATCTCGAGATACACACGGGCACACTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083314.1-1194s21c1
Sequence:CCGGCAACGCTGTCCTGGTGGTATTCTCGAGAATACCACCAGGACAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083314.1-472s21c1
Sequence:CCGGAGAACCTGGACGTCCATACATCTCGAGATGTATGGACGTCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083314.1-262s21c1
Sequence:CCGGAGAACGCCATCCGCAAGAAGACTCGAGTCTTCTTGCGGATGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083314.1-339s21c1
Sequence:CCGGGTGCAGACAGCTGTGACTATGCTCGAGCATAGTCACAGCTGTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001083314
CHMP1A MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 1A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083314.1-237s21c1
Sequence:CCGGGTAGAGTGTGCCCGTGTGTATCTCGAGATACACACGGGCACACTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083314.1-1194s21c1
Sequence:CCGGCAACGCTGTCCTGGTGGTATTCTCGAGAATACCACCAGGACAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083314.1-472s21c1
Sequence:CCGGAGAACCTGGACGTCCATACATCTCGAGATGTATGGACGTCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083314.1-262s21c1
Sequence:CCGGAGAACGCCATCCGCAAGAAGACTCGAGTCTTCTTGCGGATGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083314.1-339s21c1
Sequence:CCGGGTGCAGACAGCTGTGACTATGCTCGAGCATAGTCACAGCTGTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks