EMAIL THIS PAGE TO A FRIEND

CHMP1B

charged multivesicular body protein 1B

Synonyms: C10orf2 C18-ORF2 C18orf2 CHMP1.5 Vps46-2 Vps46B hVps46-2
UniProtKB ID: Q7LBR1, Q96E89, Q9HD41
Gene ID:
Human(57132) Summary: CHMP1B belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]
Mouse(67064) charged multivesicular body protein 1B
Rat(689364) charged multivesicular body protein 1B
Zebrafish(336426) chromatin modifying protein 1B
dog(100686812) charged multivesicular body protein 1B
chicken(422143) charged multivesicular body protein 1B
cow(512033) charged multivesicular body protein 1B
sheep(101108355) charged multivesicular body protein 1B
domestic guinea pig(100717621) charged multivesicular body protein 1B
naked mole-rat(101718227) charged multivesicular body protein 1B
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020412 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024190 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024190 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024190 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020412 Rosetta Predictions human pricing
NM_001109533 Rosetta Predictions rat pricing
NM_024190 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061121 predicted 737
2 SASI_Hs01_00061122 predicted 794
3 SASI_Hs01_00061123 predicted 843
4 SASI_Hs01_00061124 predicted 742
5 SASI_Hs01_00061125 predicted 784
6 SASI_Hs01_00061126 predicted 856
7 SASI_Hs01_00061127 predicted 870
8 SASI_Hs01_00061128 predicted 935
9 SASI_Hs02_00353415 predicted 928
10 SASI_Hs02_00353416 predicted 947
11 SASI_Hs01_00061120 predicted 216
12 SASI_Hs01_00061129 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249339 predicted 1203
2 SASI_Rn02_00249340 predicted 749
3 SASI_Rn02_00249341 predicted 1126
4 SASI_Rn02_00249342 predicted 1147
5 SASI_Rn02_00249343 predicted 799
6 SASI_Rn02_00249344 predicted 157
7 SASI_Rn02_00249345 predicted 1097
8 SASI_Rn02_00249346 predicted 1058
9 SASI_Rn02_00249347 predicted 1203
10 SASI_Rn02_00249348 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036911 predicted 692
2 SASI_Mm01_00036912 predicted 1045
3 SASI_Mm01_00036913 predicted 925
4 SASI_Mm02_00327521 predicted 834
5 SASI_Mm01_00036915 predicted 742
6 SASI_Mm01_00036916 predicted 891
7 SASI_Mm01_00036917 predicted 394
8 SASI_Mm01_00036918 predicted 474
9 SASI_Mm01_00036919 predicted 884
10 SASI_Mm01_00036920 predicted 960
11 SASI_Mm01_00036914 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020412
VALIDATED
CHMP1B MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 1B
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-520s1c1
Sequence:CCGGCCAGAACCAAGTGGATATGCTCTCGAGAGCATATCCACTTGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-214s1c1
Sequence:CCGGCAACATGGAAGTTGCGAGGATCTCGAGATCCTCGCAACTTCCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-206s1c1
Sequence:CCGGCAGAAGGGCAACATGGAAGTTCTCGAGAACTTCCATGTTGCCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-415s1c1
Sequence:CCGGGATTTCTGCTTTGATGGACAACTCGAGTTGTCCATCAAAGCAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020412.3-865s1c1
Sequence:CCGGGCTGGATTCTAAAGTTCTGTACTCGAGTACAGAACTTTAGAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-397s1c1
Sequence:CCGGGACCATGAATCTGGAGAAGATCTCGAGATCTTCTCCAGATTCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-431s1c1
Sequence:CCGGGACAAATTCGAGCACCAGTTTCTCGAGAAACTGGTGCTCGAATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020412.3-856s1c1
Sequence:CCGGGCACTCTTAGCTGGATTCTAACTCGAGTTAGAATCCAGCTAAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020412.3-386s1c1
Sequence:CCGGGCGACATTGAAGACCATGAATCTCGAGATTCATGGTCTTCAATGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-376s1c1
Sequence:CCGGGTCGATGGATGCGACATTGAACTCGAGTTCAATGTCGCATCCATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-134s1c1
Sequence:CCGGGAACTGAGTAGGAGTGCCAAACTCGAGTTTGGCACTCCTACTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020412.4-557s21c1
Sequence:CCGGCCAGAACCAAGTGGATATGCTCTCGAGAGCATATCCACTTGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020412.4-468s21c1
Sequence:CCGGGACAAATTCGAGCACCAGTTTCTCGAGAAACTGGTGCTCGAATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020412.4-434s21c1
Sequence:CCGGGACCATGAATCTGGAGAAGATCTCGAGATCTTCTCCAGATTCATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020412.4-902s21c1
Sequence:CCGGGCTGGATTCTAAAGTTCTGTACTCGAGTACAGAACTTTAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020412.4-452s21c1
Sequence:CCGGGATTTCTGCTTTGATGGACAACTCGAGTTGTCCATCAAAGCAGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020412
VALIDATED
CHMP1B MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 1B
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-520s1c1
Sequence:CCGGCCAGAACCAAGTGGATATGCTCTCGAGAGCATATCCACTTGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-214s1c1
Sequence:CCGGCAACATGGAAGTTGCGAGGATCTCGAGATCCTCGCAACTTCCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-206s1c1
Sequence:CCGGCAGAAGGGCAACATGGAAGTTCTCGAGAACTTCCATGTTGCCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-415s1c1
Sequence:CCGGGATTTCTGCTTTGATGGACAACTCGAGTTGTCCATCAAAGCAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020412.3-865s1c1
Sequence:CCGGGCTGGATTCTAAAGTTCTGTACTCGAGTACAGAACTTTAGAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-397s1c1
Sequence:CCGGGACCATGAATCTGGAGAAGATCTCGAGATCTTCTCCAGATTCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-431s1c1
Sequence:CCGGGACAAATTCGAGCACCAGTTTCTCGAGAAACTGGTGCTCGAATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020412.3-856s1c1
Sequence:CCGGGCACTCTTAGCTGGATTCTAACTCGAGTTAGAATCCAGCTAAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020412.3-386s1c1
Sequence:CCGGGCGACATTGAAGACCATGAATCTCGAGATTCATGGTCTTCAATGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-376s1c1
Sequence:CCGGGTCGATGGATGCGACATTGAACTCGAGTTCAATGTCGCATCCATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-134s1c1
Sequence:CCGGGAACTGAGTAGGAGTGCCAAACTCGAGTTTGGCACTCCTACTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020412.4-557s21c1
Sequence:CCGGCCAGAACCAAGTGGATATGCTCTCGAGAGCATATCCACTTGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020412.4-468s21c1
Sequence:CCGGGACAAATTCGAGCACCAGTTTCTCGAGAAACTGGTGCTCGAATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020412.4-434s21c1
Sequence:CCGGGACCATGAATCTGGAGAAGATCTCGAGATCTTCTCCAGATTCATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020412.4-902s21c1
Sequence:CCGGGCTGGATTCTAAAGTTCTGTACTCGAGTACAGAACTTTAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020412.4-452s21c1
Sequence:CCGGGATTTCTGCTTTGATGGACAACTCGAGTTGTCCATCAAAGCAGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020412
VALIDATED
CHMP1B MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 1B
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-520s1c1
Sequence:CCGGCCAGAACCAAGTGGATATGCTCTCGAGAGCATATCCACTTGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-214s1c1
Sequence:CCGGCAACATGGAAGTTGCGAGGATCTCGAGATCCTCGCAACTTCCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-206s1c1
Sequence:CCGGCAGAAGGGCAACATGGAAGTTCTCGAGAACTTCCATGTTGCCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-415s1c1
Sequence:CCGGGATTTCTGCTTTGATGGACAACTCGAGTTGTCCATCAAAGCAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020412.3-865s1c1
Sequence:CCGGGCTGGATTCTAAAGTTCTGTACTCGAGTACAGAACTTTAGAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-397s1c1
Sequence:CCGGGACCATGAATCTGGAGAAGATCTCGAGATCTTCTCCAGATTCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-431s1c1
Sequence:CCGGGACAAATTCGAGCACCAGTTTCTCGAGAAACTGGTGCTCGAATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020412.3-856s1c1
Sequence:CCGGGCACTCTTAGCTGGATTCTAACTCGAGTTAGAATCCAGCTAAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020412.3-386s1c1
Sequence:CCGGGCGACATTGAAGACCATGAATCTCGAGATTCATGGTCTTCAATGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-376s1c1
Sequence:CCGGGTCGATGGATGCGACATTGAACTCGAGTTCAATGTCGCATCCATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020412.3-134s1c1
Sequence:CCGGGAACTGAGTAGGAGTGCCAAACTCGAGTTTGGCACTCCTACTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020412.4-557s21c1
Sequence:CCGGCCAGAACCAAGTGGATATGCTCTCGAGAGCATATCCACTTGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020412.4-468s21c1
Sequence:CCGGGACAAATTCGAGCACCAGTTTCTCGAGAAACTGGTGCTCGAATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020412.4-434s21c1
Sequence:CCGGGACCATGAATCTGGAGAAGATCTCGAGATCTTCTCCAGATTCATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020412.4-902s21c1
Sequence:CCGGGCTGGATTCTAAAGTTCTGTACTCGAGTACAGAACTTTAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020412.4-452s21c1
Sequence:CCGGGATTTCTGCTTTGATGGACAACTCGAGTTGTCCATCAAAGCAGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024190
VALIDATED
CHMP1B MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 1B
Mouse
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024190.1-904s1c1
Sequence:CCGGGCTCTACATAAATCTAGGAAACTCGAGTTTCCTAGATTTATGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024190.1-464s1c1
Sequence:CCGGCGCAGCAAATGGAAGACACAACTCGAGTTGTGTCTTCCATTTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024190.1-207s1c1
Sequence:CCGGCAACATGGAAGTTGCGAGGATCTCGAGATCCTCGCAACTTCCATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024190.1-122s1c1
Sequence:CCGGCCAAAGAACTGAACCGGAGTTCTCGAGAACTCCGGTTCAGTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024190.1-411s1c1
Sequence:CCGGCTCCGCTTTGATGGACAAATTCTCGAGAATTTGTCCATCAAAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024190.1-412s21c1
Sequence:GTACCGGTCCGCTTTGATGGACAAATTCCTCGAGGAATTTGTCCATCAAAGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-193s21c1
Sequence:GTACCGGGCCATTCAGAAGGGCAACATGCTCGAGCATGTTGCCCTTCTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-370s21c1
Sequence:GTACCGGTCGATGGACGCGACGTTGAAACTCGAGTTTCAACGTCGCGTCCATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024190.1-433s21c1
Sequence:GTACCGGGAACACCAGTTCGAGACTCTGCTCGAGCAGAGTCTCGAACTGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-453s21c1
Sequence:GTACCGGGGACGTCCAGACGCAGCAAATCTCGAGATTTGCTGCGTCTGGACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-904s21c1
Sequence:CCGGGCTCTACATAAATCTAGGAAACTCGAGTTTCCTAGATTTATGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-319s21c1
Sequence:CCGGACTGCAGTGACGATGGGCAAACTCGAGTTTGCCCATCGTCACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-242s21c1
Sequence:CCGGCCATCCGCCAGAAGAATCAAGCTCGAGCTTGATTCTTCTGGCGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-620s21c1
Sequence:CCGGCTTCGGCTGAGCAAGATGAACCTCGAGGTTCATCTTGCTCAGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-209s21c1
Sequence:GTACCGGACATGGAAGTTGCGAGGATTCCTCGAGGAATCCTCGCAACTTCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-276s21c1
Sequence:GTACCGGGAGAATGAGTGCACGAGTGGACTCGAGTCCACTCGTGCACTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-263s21c1
Sequence:GTACCGGGGGTGAACTTCTTGAGAATGACTCGAGTCATTCTCAAGAAGTTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024190
VALIDATED
CHMP1B MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 1B
Mouse
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024190.1-904s1c1
Sequence:CCGGGCTCTACATAAATCTAGGAAACTCGAGTTTCCTAGATTTATGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024190.1-464s1c1
Sequence:CCGGCGCAGCAAATGGAAGACACAACTCGAGTTGTGTCTTCCATTTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024190.1-207s1c1
Sequence:CCGGCAACATGGAAGTTGCGAGGATCTCGAGATCCTCGCAACTTCCATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024190.1-122s1c1
Sequence:CCGGCCAAAGAACTGAACCGGAGTTCTCGAGAACTCCGGTTCAGTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024190.1-411s1c1
Sequence:CCGGCTCCGCTTTGATGGACAAATTCTCGAGAATTTGTCCATCAAAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024190.1-412s21c1
Sequence:GTACCGGTCCGCTTTGATGGACAAATTCCTCGAGGAATTTGTCCATCAAAGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-193s21c1
Sequence:GTACCGGGCCATTCAGAAGGGCAACATGCTCGAGCATGTTGCCCTTCTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-370s21c1
Sequence:GTACCGGTCGATGGACGCGACGTTGAAACTCGAGTTTCAACGTCGCGTCCATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024190.1-433s21c1
Sequence:GTACCGGGAACACCAGTTCGAGACTCTGCTCGAGCAGAGTCTCGAACTGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-453s21c1
Sequence:GTACCGGGGACGTCCAGACGCAGCAAATCTCGAGATTTGCTGCGTCTGGACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-904s21c1
Sequence:CCGGGCTCTACATAAATCTAGGAAACTCGAGTTTCCTAGATTTATGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-319s21c1
Sequence:CCGGACTGCAGTGACGATGGGCAAACTCGAGTTTGCCCATCGTCACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-242s21c1
Sequence:CCGGCCATCCGCCAGAAGAATCAAGCTCGAGCTTGATTCTTCTGGCGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-620s21c1
Sequence:CCGGCTTCGGCTGAGCAAGATGAACCTCGAGGTTCATCTTGCTCAGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-209s21c1
Sequence:GTACCGGACATGGAAGTTGCGAGGATTCCTCGAGGAATCCTCGCAACTTCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-276s21c1
Sequence:GTACCGGGAGAATGAGTGCACGAGTGGACTCGAGTCCACTCGTGCACTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-263s21c1
Sequence:GTACCGGGGGTGAACTTCTTGAGAATGACTCGAGTCATTCTCAAGAAGTTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024190
VALIDATED
CHMP1B MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 1B
Mouse
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024190.1-904s1c1
Sequence:CCGGGCTCTACATAAATCTAGGAAACTCGAGTTTCCTAGATTTATGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024190.1-464s1c1
Sequence:CCGGCGCAGCAAATGGAAGACACAACTCGAGTTGTGTCTTCCATTTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024190.1-207s1c1
Sequence:CCGGCAACATGGAAGTTGCGAGGATCTCGAGATCCTCGCAACTTCCATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024190.1-122s1c1
Sequence:CCGGCCAAAGAACTGAACCGGAGTTCTCGAGAACTCCGGTTCAGTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024190.1-411s1c1
Sequence:CCGGCTCCGCTTTGATGGACAAATTCTCGAGAATTTGTCCATCAAAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024190.1-412s21c1
Sequence:GTACCGGTCCGCTTTGATGGACAAATTCCTCGAGGAATTTGTCCATCAAAGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-193s21c1
Sequence:GTACCGGGCCATTCAGAAGGGCAACATGCTCGAGCATGTTGCCCTTCTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-370s21c1
Sequence:GTACCGGTCGATGGACGCGACGTTGAAACTCGAGTTTCAACGTCGCGTCCATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024190.1-433s21c1
Sequence:GTACCGGGAACACCAGTTCGAGACTCTGCTCGAGCAGAGTCTCGAACTGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-453s21c1
Sequence:GTACCGGGGACGTCCAGACGCAGCAAATCTCGAGATTTGCTGCGTCTGGACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-904s21c1
Sequence:CCGGGCTCTACATAAATCTAGGAAACTCGAGTTTCCTAGATTTATGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-319s21c1
Sequence:CCGGACTGCAGTGACGATGGGCAAACTCGAGTTTGCCCATCGTCACTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-242s21c1
Sequence:CCGGCCATCCGCCAGAAGAATCAAGCTCGAGCTTGATTCTTCTGGCGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-620s21c1
Sequence:CCGGCTTCGGCTGAGCAAGATGAACCTCGAGGTTCATCTTGCTCAGCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-209s21c1
Sequence:GTACCGGACATGGAAGTTGCGAGGATTCCTCGAGGAATCCTCGCAACTTCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-276s21c1
Sequence:GTACCGGGAGAATGAGTGCACGAGTGGACTCGAGTCCACTCGTGCACTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024190.1-263s21c1
Sequence:GTACCGGGGGTGAACTTCTTGAGAATGACTCGAGTCATTCTCAAGAAGTTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks