EMAIL THIS PAGE TO A FRIEND

CHMP2A

charged multivesicular body protein 2A

63 Gene Product Result for
Synonyms: BC-2 BC2 CHMP2 VPS2 VPS2A
UniProtKB ID: O43633, B2R4W6, Q3ZTT0
Gene ID:
Human(27243) Summary: CHMP2A belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]
Mouse(68953) charged multivesicular body protein 2A
Rat(365191) charged multivesicular body protein 2A
naked mole-rat(101722413) charged multivesicular body protein 2A
domestic guinea pig(100717259) charged multivesicular body protein 2A
sheep(101112505) charged multivesicular body protein 2A
chicken(776036) charged multivesicular body protein 2A
dog(476364) charged multivesicular body protein 2A
domestic cat(101085934) charged multivesicular body protein 2A
cow(523847) charged multivesicular body protein 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026885 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026885 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026885 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014453 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053251 MISSION® esiRNA esiRNA human CHMP2A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014453 Rosetta Predictions human pricing
NM_198426 Rosetta Predictions human pricing
NM_001108906 Rosetta Predictions rat pricing
NM_026885 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147682 predicted 351
2 SASI_Hs01_00147683 predicted 346
3 SASI_Hs02_00345668 predicted 320
4 SASI_Hs01_00147684 predicted 368
5 SASI_Hs01_00147685 predicted 407
6 SASI_Hs01_00147686 predicted 848
7 SASI_Hs02_00345669 predicted 458
8 SASI_Hs01_00147688 predicted 434
9 SASI_Hs01_00147689 predicted 182
10 SASI_Hs01_00147690 predicted 300
11 SASI_Hs01_00147687 predicted 332
12 SASI_Hs01_00147691 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122748 predicted 354
2 SASI_Hs01_00122749 predicted 351
3 SASI_Hs01_00122750 predicted 399
4 SASI_Hs02_00371938 predicted 446
5 SASI_Hs01_00122751 predicted 351
6 SASI_Hs01_00122752 predicted 425
7 SASI_Hs01_00122753 predicted 355
8 SASI_Hs01_00122754 predicted 435
9 SASI_Hs01_00122755 predicted 669
10 SASI_Hs01_00122756 predicted 657
11 SASI_Hs01_00122757 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243255 predicted 684
2 SASI_Rn02_00243256 predicted 342
3 SASI_Rn02_00243257 predicted 475
4 SASI_Rn02_00243258 predicted 425
5 SASI_Rn02_00243259 predicted 373
6 SASI_Rn02_00243260 predicted 464
7 SASI_Rn02_00243261 predicted 425
8 SASI_Rn02_00243262 predicted 399
9 SASI_Rn02_00243263 predicted 201
10 SASI_Rn02_00243264 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035835 predicted 415
2 SASI_Mm01_00035837 predicted 319
3 SASI_Mm01_00035838 predicted 396
4 SASI_Mm01_00035839 predicted 453
5 SASI_Mm02_00331140 predicted 402
6 SASI_Mm01_00035840 predicted 312
7 SASI_Mm01_00035842 predicted 465
8 SASI_Mm01_00035843 predicted 568
9 SASI_Mm01_00035844 predicted 482
10 SASI_Mm02_00331141 predicted 213
11 SASI_Mm01_00035836 predicted 364
12 SASI_Mm01_00035841 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026885
VALIDATED
CHMP2A MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 2A
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026885.3-396s21c1
Sequence:CCGGCCGGAGATATGTACGCAAGTTCTCGAGAACTTGCGTACATATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026885.2-457s21c1
Sequence:CCGGCAAGCCATGAAGGGTGTTACTCTCGAGAGTAACACCCTTCATGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026885.2-249s21c1
Sequence:CCGGGGAACGACAGAAACTAGAAACCTCGAGGTTTCTAGTTTCTGTCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026885.2-491s1c1
Sequence:CCGGCTATGAACAGACAGCTGAAATCTCGAGATTTCAGCTGTCTGTTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026885.2-577s21c1
Sequence:CCGGGAAATGATGAATGACGCAATTCTCGAGAATTGCGTCATTCATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026885.2-322s21c1
Sequence:CCGGATGGATGCTGTTCGAATCATGCTCGAGCATGATTCGAACAGCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026885.3-712s21c1
Sequence:CCGGCTCACAGATGAGCTGTCAAACCTCGAGGTTTGACAGCTCATCTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026885.2-417s21c5
Sequence:CCGGCCTCAAGATACAGACTCTAAACTCGAGTTTAGAGTCTGTATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026885.1-626s1c1
Sequence:CCGGGAAGAGGAGAGTGATGCTGTTCTCGAGAACAGCATCACTCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026885.1-365s1c1
Sequence:CCGGCGGAGATATGTACGCAAGTTTCTCGAGAAACTTGCGTACATATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026885.1-418s1c1
Sequence:CCGGCCTCAAGATACAGACTCTAAACTCGAGTTTAGAGTCTGTATCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026885.1-257s1c1
Sequence:CCGGCAGAAACTAGAAACCCAGGAACTCGAGTTCCTGGGTTTCTAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026885.1-466s1c1
Sequence:CCGGGAAGGGTGTTACTAAGGCCATCTCGAGATGGCCTTAGTAACACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026885.1-578s1c1
Sequence:CCGGGAAATGATGAATGACGCAATTCTCGAGAATTGCGTCATTCATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026885.1-458s1c1
Sequence:CCGGCAAGCCATGAAGGGTGTTACTCTCGAGAGTAACACCCTTCATGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026885
VALIDATED
CHMP2A MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 2A
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026885.3-396s21c1
Sequence:CCGGCCGGAGATATGTACGCAAGTTCTCGAGAACTTGCGTACATATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026885.2-457s21c1
Sequence:CCGGCAAGCCATGAAGGGTGTTACTCTCGAGAGTAACACCCTTCATGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026885.2-249s21c1
Sequence:CCGGGGAACGACAGAAACTAGAAACCTCGAGGTTTCTAGTTTCTGTCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026885.2-491s1c1
Sequence:CCGGCTATGAACAGACAGCTGAAATCTCGAGATTTCAGCTGTCTGTTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026885.2-577s21c1
Sequence:CCGGGAAATGATGAATGACGCAATTCTCGAGAATTGCGTCATTCATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026885.2-322s21c1
Sequence:CCGGATGGATGCTGTTCGAATCATGCTCGAGCATGATTCGAACAGCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026885.3-712s21c1
Sequence:CCGGCTCACAGATGAGCTGTCAAACCTCGAGGTTTGACAGCTCATCTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026885.2-417s21c5
Sequence:CCGGCCTCAAGATACAGACTCTAAACTCGAGTTTAGAGTCTGTATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026885.1-626s1c1
Sequence:CCGGGAAGAGGAGAGTGATGCTGTTCTCGAGAACAGCATCACTCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026885.1-365s1c1
Sequence:CCGGCGGAGATATGTACGCAAGTTTCTCGAGAAACTTGCGTACATATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026885.1-418s1c1
Sequence:CCGGCCTCAAGATACAGACTCTAAACTCGAGTTTAGAGTCTGTATCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026885.1-257s1c1
Sequence:CCGGCAGAAACTAGAAACCCAGGAACTCGAGTTCCTGGGTTTCTAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026885.1-466s1c1
Sequence:CCGGGAAGGGTGTTACTAAGGCCATCTCGAGATGGCCTTAGTAACACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026885.1-578s1c1
Sequence:CCGGGAAATGATGAATGACGCAATTCTCGAGAATTGCGTCATTCATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026885.1-458s1c1
Sequence:CCGGCAAGCCATGAAGGGTGTTACTCTCGAGAGTAACACCCTTCATGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026885
VALIDATED
CHMP2A MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 2A
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026885.3-396s21c1
Sequence:CCGGCCGGAGATATGTACGCAAGTTCTCGAGAACTTGCGTACATATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026885.2-457s21c1
Sequence:CCGGCAAGCCATGAAGGGTGTTACTCTCGAGAGTAACACCCTTCATGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026885.2-249s21c1
Sequence:CCGGGGAACGACAGAAACTAGAAACCTCGAGGTTTCTAGTTTCTGTCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026885.2-491s1c1
Sequence:CCGGCTATGAACAGACAGCTGAAATCTCGAGATTTCAGCTGTCTGTTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026885.2-577s21c1
Sequence:CCGGGAAATGATGAATGACGCAATTCTCGAGAATTGCGTCATTCATCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026885.2-322s21c1
Sequence:CCGGATGGATGCTGTTCGAATCATGCTCGAGCATGATTCGAACAGCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026885.3-712s21c1
Sequence:CCGGCTCACAGATGAGCTGTCAAACCTCGAGGTTTGACAGCTCATCTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026885.2-417s21c5
Sequence:CCGGCCTCAAGATACAGACTCTAAACTCGAGTTTAGAGTCTGTATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026885.1-626s1c1
Sequence:CCGGGAAGAGGAGAGTGATGCTGTTCTCGAGAACAGCATCACTCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026885.1-365s1c1
Sequence:CCGGCGGAGATATGTACGCAAGTTTCTCGAGAAACTTGCGTACATATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026885.1-418s1c1
Sequence:CCGGCCTCAAGATACAGACTCTAAACTCGAGTTTAGAGTCTGTATCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026885.1-257s1c1
Sequence:CCGGCAGAAACTAGAAACCCAGGAACTCGAGTTCCTGGGTTTCTAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026885.1-466s1c1
Sequence:CCGGGAAGGGTGTTACTAAGGCCATCTCGAGATGGCCTTAGTAACACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026885.1-578s1c1
Sequence:CCGGGAAATGATGAATGACGCAATTCTCGAGAATTGCGTCATTCATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026885.1-458s1c1
Sequence:CCGGCAAGCCATGAAGGGTGTTACTCTCGAGAGTAACACCCTTCATGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014453
VALIDATED
CHMP2A MISSION shRNA Bacterial Glycerol Stock
charged multivesicular body protein 2A
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-525s1c1
Sequence:CCGGGAAGATCATGATGGAGTTTGACTCGAGTCAAACTCCATCATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014453.2-523s1c1
Sequence:CCGGCAGAAGATCATGATGGAGTTTCTCGAGAAACTCCATCATGATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014453.2-307s1c1
Sequence:CCGGGCCAAGCAAGGCCAGATGGATCTCGAGATCCATCTGGCCTTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-561s1c1
Sequence:CCGGCATGGATATGAAGGAGGAGATCTCGAGATCTCCTCCTTCATATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-522s1c1
Sequence:CCGGCCAGAAGATCATGATGGAGTTCTCGAGAACTCCATCATGATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014453.2-368s1c1
Sequence:CCGGGCTATGTGCGCAAGTTTGTATCTCGAGATACAAACTTGCGCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-619s1c1
Sequence:CCGGGAAGATGAAGAGGAGAGTGATCTCGAGATCACTCTCCTCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-489s1c1
Sequence:CCGGCACCATGAACAGACAGCTGAACTCGAGTTCAGCTGTCTGTTCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-262s1c1
Sequence:CCGGCTAGAGACCCAGGAGAAGAAACTCGAGTTTCTTCTCCTGGGTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-426s1c1
Sequence:CCGGCCAGACACTCAAGTCCAACAACTCGAGTTGTTGGACTTGAGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014453.2-594s1c1
Sequence:CCGGCATTGATGATGCCATGGGTGACTCGAGTCACCCATGGCATCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-258s1c1
Sequence:CCGGGAAACTAGAGACCCAGGAGAACTCGAGTTCTCCTGGGTCTCTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-417s1c1
Sequence:CCGGCCTCAAGATCCAGACACTCAACTCGAGTTGAGTGTCTGGATCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014453.2-549s1c1
Sequence:CCGGGCAGGCAGAGATCATGGATATCTCGAGATATCCATGATCTCTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-516s1c1
Sequence:CCGGCCAGATCCAGAAGATCATGATCTCGAGATCATGATCTTCTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014453.2-492s1c1
Sequence:CCGGCATGAACAGACAGCTGAAGTTCTCGAGAACTTCAGCTGTCTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014453
VALIDATED
CHMP2A MISSION shRNA shRNA Plasmid DNA
charged multivesicular body protein 2A
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-525s1c1
Sequence:CCGGGAAGATCATGATGGAGTTTGACTCGAGTCAAACTCCATCATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014453.2-523s1c1
Sequence:CCGGCAGAAGATCATGATGGAGTTTCTCGAGAAACTCCATCATGATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014453.2-307s1c1
Sequence:CCGGGCCAAGCAAGGCCAGATGGATCTCGAGATCCATCTGGCCTTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-561s1c1
Sequence:CCGGCATGGATATGAAGGAGGAGATCTCGAGATCTCCTCCTTCATATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-522s1c1
Sequence:CCGGCCAGAAGATCATGATGGAGTTCTCGAGAACTCCATCATGATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014453.2-368s1c1
Sequence:CCGGGCTATGTGCGCAAGTTTGTATCTCGAGATACAAACTTGCGCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-619s1c1
Sequence:CCGGGAAGATGAAGAGGAGAGTGATCTCGAGATCACTCTCCTCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-489s1c1
Sequence:CCGGCACCATGAACAGACAGCTGAACTCGAGTTCAGCTGTCTGTTCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-262s1c1
Sequence:CCGGCTAGAGACCCAGGAGAAGAAACTCGAGTTTCTTCTCCTGGGTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-426s1c1
Sequence:CCGGCCAGACACTCAAGTCCAACAACTCGAGTTGTTGGACTTGAGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014453.2-594s1c1
Sequence:CCGGCATTGATGATGCCATGGGTGACTCGAGTCACCCATGGCATCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-258s1c1
Sequence:CCGGGAAACTAGAGACCCAGGAGAACTCGAGTTCTCCTGGGTCTCTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-417s1c1
Sequence:CCGGCCTCAAGATCCAGACACTCAACTCGAGTTGAGTGTCTGGATCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014453.2-549s1c1
Sequence:CCGGGCAGGCAGAGATCATGGATATCTCGAGATATCCATGATCTCTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-516s1c1
Sequence:CCGGCCAGATCCAGAAGATCATGATCTCGAGATCATGATCTTCTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014453.2-492s1c1
Sequence:CCGGCATGAACAGACAGCTGAAGTTCTCGAGAACTTCAGCTGTCTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014453
VALIDATED
CHMP2A MISSION shRNA Lentiviral Transduction Particles
charged multivesicular body protein 2A
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-525s1c1
Sequence:CCGGGAAGATCATGATGGAGTTTGACTCGAGTCAAACTCCATCATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014453.2-523s1c1
Sequence:CCGGCAGAAGATCATGATGGAGTTTCTCGAGAAACTCCATCATGATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014453.2-307s1c1
Sequence:CCGGGCCAAGCAAGGCCAGATGGATCTCGAGATCCATCTGGCCTTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-561s1c1
Sequence:CCGGCATGGATATGAAGGAGGAGATCTCGAGATCTCCTCCTTCATATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-522s1c1
Sequence:CCGGCCAGAAGATCATGATGGAGTTCTCGAGAACTCCATCATGATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014453.2-368s1c1
Sequence:CCGGGCTATGTGCGCAAGTTTGTATCTCGAGATACAAACTTGCGCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-619s1c1
Sequence:CCGGGAAGATGAAGAGGAGAGTGATCTCGAGATCACTCTCCTCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-489s1c1
Sequence:CCGGCACCATGAACAGACAGCTGAACTCGAGTTCAGCTGTCTGTTCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-262s1c1
Sequence:CCGGCTAGAGACCCAGGAGAAGAAACTCGAGTTTCTTCTCCTGGGTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-426s1c1
Sequence:CCGGCCAGACACTCAAGTCCAACAACTCGAGTTGTTGGACTTGAGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014453.2-594s1c1
Sequence:CCGGCATTGATGATGCCATGGGTGACTCGAGTCACCCATGGCATCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-258s1c1
Sequence:CCGGGAAACTAGAGACCCAGGAGAACTCGAGTTCTCCTGGGTCTCTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-417s1c1
Sequence:CCGGCCTCAAGATCCAGACACTCAACTCGAGTTGAGTGTCTGGATCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014453.2-549s1c1
Sequence:CCGGGCAGGCAGAGATCATGGATATCTCGAGATATCCATGATCTCTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014453.2-516s1c1
Sequence:CCGGCCAGATCCAGAAGATCATGATCTCGAGATCATGATCTTCTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014453.2-492s1c1
Sequence:CCGGCATGAACAGACAGCTGAAGTTCTCGAGAACTTCAGCTGTCTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks